ID: 1070479701

View in Genome Browser
Species Human (GRCh38)
Location 10:76870235-76870257
Sequence GACTCAGGGTCAGCGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070479701_1070479711 -2 Left 1070479701 10:76870235-76870257 CCTTCCCACGCTGACCCTGAGTC 0: 1
1: 0
2: 2
3: 33
4: 282
Right 1070479711 10:76870256-76870278 TCCCATGGGAGGGAAGCACTGGG 0: 1
1: 0
2: 2
3: 21
4: 270
1070479701_1070479714 11 Left 1070479701 10:76870235-76870257 CCTTCCCACGCTGACCCTGAGTC 0: 1
1: 0
2: 2
3: 33
4: 282
Right 1070479714 10:76870269-76870291 AAGCACTGGGTCACTCCCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1070479701_1070479710 -3 Left 1070479701 10:76870235-76870257 CCTTCCCACGCTGACCCTGAGTC 0: 1
1: 0
2: 2
3: 33
4: 282
Right 1070479710 10:76870255-76870277 GTCCCATGGGAGGGAAGCACTGG 0: 1
1: 0
2: 0
3: 23
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070479701 Original CRISPR GACTCAGGGTCAGCGTGGGA AGG (reversed) Intronic
900271783 1:1793906-1793928 GCCACAGGGTCAGGGTGGCAAGG + Intronic
900418404 1:2545441-2545463 GACTCATGGCCAGCGTGTGGGGG - Intergenic
901445870 1:9307877-9307899 GGCACAGGGTAAGCCTGGGAGGG - Intronic
902683270 1:18058740-18058762 GGCACAGGGTCAGAGAGGGACGG - Intergenic
902711896 1:18246180-18246202 GACTCAGGGAGGGCCTGGGATGG - Intronic
903660328 1:24973254-24973276 GACTCAGGGTCTGCCTGTGGGGG - Intergenic
904225210 1:29011400-29011422 GACTAAAGGTCAGGGTTGGAGGG + Intronic
904401610 1:30260340-30260362 CTCTGAGGGTCAGAGTGGGAGGG - Intergenic
905510586 1:38516745-38516767 GACTCTGGGTGTGCGTGTGAAGG - Intergenic
907575447 1:55521890-55521912 CACCCAGGGACAGTGTGGGAGGG - Intergenic
909592833 1:77371041-77371063 CTCTCTGGGTCAGCATGGGATGG - Intronic
910770468 1:90825858-90825880 AACTCAGAGTCAGTGTTGGAAGG + Intergenic
911507817 1:98775332-98775354 GTCTCGGGGTCAGAGTGGGATGG + Intergenic
912388874 1:109287841-109287863 GACTCAGGGAAAGGGTGGGATGG - Intergenic
913338214 1:117730438-117730460 GACTCGGGGAGAGAGTGGGAGGG + Intergenic
915235738 1:154480037-154480059 CACACAGGGTCAGCGGTGGAGGG + Exonic
915448823 1:155990547-155990569 GACTGAGGGTGGGAGTGGGAGGG - Intronic
915942750 1:160129226-160129248 AATTCAGTGTCAGCATGGGAGGG - Intronic
916119368 1:161513823-161513845 GCCTCAGCATCAGCGTGGGCAGG + Intronic
916129130 1:161595481-161595503 GCCTCAGCATCAGCGTGGGCAGG + Intronic
919407592 1:197203945-197203967 GATTCAGGGAAAGGGTGGGAGGG - Intergenic
920647996 1:207817341-207817363 GACTCAGGCTCAGCTGAGGATGG - Intergenic
921425995 1:215001686-215001708 AACTCAGAGTCAGTGTGGGAAGG - Intergenic
923007021 1:230058211-230058233 CACTCAGGGGCAGCCTGGGCTGG + Intronic
923722492 1:236479008-236479030 GACTCAGGGAAAAGGTGGGAAGG + Intronic
923896058 1:238271294-238271316 GACTCAAGGACAACATGGGAGGG - Intergenic
924477683 1:244395858-244395880 GACTCAAGCTCAGAGAGGGAAGG - Intergenic
924895609 1:248335527-248335549 GAGTCAGGGGAAGGGTGGGAGGG - Intergenic
924935899 1:248770004-248770026 GACTCAGGGAAAGGGTGGAAAGG + Intergenic
1065874710 10:29987083-29987105 GACTCAGGGGAAAGGTGGGAGGG - Intergenic
1067526930 10:47044780-47044802 GAGGCAGGGTGAGCCTGGGATGG + Intergenic
1070341571 10:75503003-75503025 GTCTCAGGTTCAGTGTGAGAAGG - Intronic
1070479701 10:76870235-76870257 GACTCAGGGTCAGCGTGGGAAGG - Intronic
1072324891 10:94288227-94288249 GACTCAGAATGAGAGTGGGAGGG - Intronic
1073267737 10:102238348-102238370 GACTCAGGTTCAGGACGGGAGGG - Intronic
1073514051 10:104061485-104061507 GAAGCTGGGTCAGCATGGGAGGG + Intronic
1075166259 10:120070883-120070905 GACTCAGGGCCAGCTTCTGAGGG - Intergenic
1075615134 10:123885206-123885228 GACTCAGGGTGGGGTTGGGAGGG + Intronic
1076135271 10:128041225-128041247 GAGTCAGGGTCAGCCTTGGCTGG + Intronic
1076368598 10:129937345-129937367 CACTCAGGGTCACCCAGGGAAGG - Intronic
1076545496 10:131243203-131243225 AGTCCAGGGTCAGCGTGGGAGGG - Intronic
1077034415 11:487908-487930 GTCTCAGGGTGAGCGTGGGGTGG - Intronic
1077218473 11:1404917-1404939 GACACAGGGGCAGCGAGGGCTGG - Intronic
1077532153 11:3102356-3102378 GACGGAGGGGCAGCGTGGGTGGG + Intronic
1078251308 11:9618892-9618914 GGCTCTGGGTCAGATTGGGAAGG - Intergenic
1080114560 11:28607155-28607177 GACTCAGAGTCAGCGAGAGGTGG + Intergenic
1081809662 11:45907750-45907772 GTCTCAGGGTCTACGTGAGAGGG + Intergenic
1083670116 11:64295134-64295156 GACACAGGGTCTGCCTTGGAGGG + Intronic
1084819782 11:71678246-71678268 GACTCAGGGGGAAGGTGGGAGGG + Intergenic
1084972554 11:72779881-72779903 GGCTCAGGGTCAGAGGGGAAAGG + Intronic
1085523123 11:77149779-77149801 GACTGAGGGACAGAGTGAGAGGG - Intronic
1085604341 11:77883804-77883826 GAGTCAGGACCAGGGTGGGAAGG - Intronic
1088430569 11:109753984-109754006 TACTCATGGTCAGCTTGGGGGGG + Intergenic
1090929213 11:131280253-131280275 GACCCAGAGTCAGTGTGGGAGGG - Intergenic
1091671366 12:2454397-2454419 GAGTCAGGGTGAGAGAGGGAGGG - Intronic
1093948979 12:25142337-25142359 GACTCAAGGGAAGGGTGGGAGGG + Intronic
1096106232 12:48998304-48998326 GACCCAGGGTCGGCGTGGGCGGG - Exonic
1096252644 12:50042920-50042942 CACTGTGGGTCAGAGTGGGAGGG - Intergenic
1098001188 12:65945091-65945113 GCCTCAGGGGCATCCTGGGAGGG + Intronic
1102984357 12:117266258-117266280 GACTCGGGGAAAGGGTGGGAAGG - Intronic
1103035359 12:117652150-117652172 GACTCAGGGGCAGTGTGGGAGGG + Intronic
1103880299 12:124160819-124160841 GACTCGGGGAAAGGGTGGGAAGG - Intronic
1103933239 12:124461441-124461463 GACTCTGGGTCTGCGTGGCCAGG + Intronic
1103941569 12:124504048-124504070 AACCCAGACTCAGCGTGGGAGGG + Intronic
1104034878 12:125091327-125091349 GAGCCAAGGTCAGAGTGGGAAGG - Intronic
1104882933 12:132084670-132084692 GGCGCAGGGTCACCGAGGGATGG - Intronic
1106781786 13:33066431-33066453 GACTCAGAGTCAGCATGAGGCGG - Intergenic
1107522200 13:41194324-41194346 GTCTTAGCGTCAGCGAGGGAAGG - Exonic
1107624878 13:42272125-42272147 GGCTGGGGGTCAGCGCGGGAGGG + Intergenic
1110657349 13:78015914-78015936 GACTCAGGGGAAAAGTGGGAGGG - Intergenic
1116545143 14:46156116-46156138 GACTCGGGGAAAGGGTGGGAGGG - Intergenic
1116871196 14:50070459-50070481 GAATCAGAGACAGGGTGGGAGGG + Intergenic
1118902776 14:70000697-70000719 AACTCAGTCTCTGCGTGGGAAGG + Intronic
1119091934 14:71790951-71790973 GACTCGGGGGAAGGGTGGGAGGG - Intergenic
1119867793 14:77988589-77988611 GACTCAGAGGCAGAGTGGGGAGG + Intergenic
1122075241 14:99231378-99231400 GACTCAGGGTGAGGGTCAGACGG - Exonic
1122203411 14:100136206-100136228 GACTCAGGGTCCTGGTGGGAAGG - Intronic
1122725427 14:103747661-103747683 GACTCGGGGAAAGGGTGGGAAGG - Intronic
1123014052 14:105365173-105365195 GTCTCAGGGTCAGCAGGGGCAGG + Intronic
1124360791 15:29035331-29035353 GATTCAGGAACAGCCTGGGAGGG + Intronic
1124612822 15:31220235-31220257 GACACAGGCTGAGCGGGGGATGG - Intergenic
1127372968 15:58357510-58357532 AACCCAGGGCCAGCATGGGATGG + Intronic
1127970254 15:63953130-63953152 GACTCGGGGGAAGGGTGGGAGGG - Intronic
1129938415 15:79470988-79471010 GTCTCAGGGTCAGGGAAGGAAGG - Exonic
1130299366 15:82668119-82668141 GACTCTGGGTCAGCATCTGAGGG - Intronic
1130780052 15:87026977-87026999 GACTCAGGGAAAGGGTGGGAAGG + Intronic
1131307204 15:91255461-91255483 GACTCGGGGAAAGGGTGGGAAGG + Intronic
1131469293 15:92682494-92682516 GACTCAGGGAAAGAGTGCGAAGG - Intronic
1131535748 15:93236317-93236339 GACCCAGGCTCAGTGTGGGCTGG + Intergenic
1132723391 16:1327807-1327829 GAATCAGGGTCGGCTGGGGATGG - Intergenic
1133909517 16:10052402-10052424 GACTTAGGGTGAGCATGGGAAGG - Intronic
1136933048 16:34435956-34435978 GACTCAGGGTGAAGATGGGAGGG + Intergenic
1136971524 16:34975858-34975880 GACTCAGGGTGAAGATGGGAGGG - Intergenic
1138420704 16:56897378-56897400 GCCCCAGGGTCAGAGTAGGAGGG + Intronic
1139327497 16:66163778-66163800 GCCACAGGACCAGCGTGGGAGGG + Intergenic
1139473988 16:67193335-67193357 GACTCAGGTCCACCGGGGGAGGG - Intronic
1139613657 16:68076121-68076143 GACACAGTGACAGGGTGGGAGGG - Intronic
1141028631 16:80569811-80569833 GGCCCAGAGTCAGCGTGAGAGGG + Intergenic
1143164839 17:4892619-4892641 GAGTCAGGGTCAGGGAGGCACGG - Intronic
1143308364 17:5967873-5967895 GACTCGGGGAAAGGGTGGGAAGG - Intronic
1143356202 17:6330661-6330683 CACTCAGGGTGAGCTTGAGAAGG - Intergenic
1143768243 17:9151432-9151454 GAGTCACAGTCAGAGTGGGACGG - Intronic
1143997769 17:11022832-11022854 GACTCAGGGGGAATGTGGGAGGG + Intergenic
1144956886 17:19023165-19023187 CACTCAGGGTCAGGCAGGGAAGG + Intronic
1144970504 17:19106262-19106284 GACTCAGGCTCAGAGCTGGAAGG + Intergenic
1144990807 17:19232424-19232446 GACTCAGGCTCAGAGCTGGAAGG + Intronic
1145037709 17:19552855-19552877 GGCCCAGGGTCAGCGTGCGCAGG + Intronic
1146816073 17:35943574-35943596 AACCCAGGGTCAGAGAGGGATGG - Exonic
1147387579 17:40091195-40091217 GGCTGAGGGTCAGGGTGGGGTGG - Intronic
1147429992 17:40364939-40364961 GACTGAGGGTCTGTCTGGGAAGG - Intergenic
1148231331 17:45937016-45937038 GACTCTGAGTAGGCGTGGGACGG - Intronic
1150457138 17:65315355-65315377 GACTCAGGGGAAAGGTGGGAGGG + Intergenic
1151044550 17:70904047-70904069 GGCTCAGGGGAAGGGTGGGAGGG - Intergenic
1151268068 17:72971810-72971832 GACTCAGGGGCTGGGTGGGAGGG + Intronic
1151423980 17:74017619-74017641 GAGTCAGGGTCAGCAGGGGTTGG + Intergenic
1152405894 17:80097621-80097643 GGCTCATGTTCAGCGTGCGAGGG + Intronic
1152574883 17:81135600-81135622 GAAACAGGGTCAGTGTGGGCAGG + Intronic
1153065957 18:1045468-1045490 GACTCGGGGAAAGGGTGGGAAGG + Intergenic
1154001835 18:10488169-10488191 GACTCAGGGGCTGGGAGGGAGGG - Exonic
1155498083 18:26462057-26462079 AACTCAGGGTCAGCATGGGGAGG - Intronic
1156035326 18:32760210-32760232 ATGTCAGGGTCAGGGTGGGATGG - Intronic
1162031375 19:7918883-7918905 GGCTGAGGCTCAGCGAGGGAGGG - Intronic
1162530651 19:11234395-11234417 GAGTCAGGGTCAGCCAGGCATGG - Intronic
1163476149 19:17527191-17527213 GACGCAGGTGCAGCGTGGGGTGG + Intronic
1163519601 19:17784107-17784129 GTCTCAGGGTCACTCTGGGAGGG - Exonic
1165247553 19:34505866-34505888 GGCTCCGGGACAGTGTGGGATGG - Exonic
1167962995 19:53122474-53122496 GTCACAGGGTCAGGGTGAGACGG + Exonic
1168145353 19:54416965-54416987 GGGTCAGGGTCAGGGTGGCAGGG + Intronic
1168300432 19:55401774-55401796 GGCTCAGGGTCACAGTGGGTCGG + Intronic
1168607249 19:57769910-57769932 GCCTCAGGGTCTGGGTGGGTAGG - Intronic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
926520039 2:13898642-13898664 GAGAGAGTGTCAGCGTGGGAAGG - Intergenic
926889435 2:17626560-17626582 GACACAGGGGCAGGGTGGGTGGG - Intronic
928170859 2:29002292-29002314 AATTCAGAGGCAGCGTGGGAAGG - Intronic
928476994 2:31637741-31637763 GACTGGGGCTCAGCTTGGGAGGG - Intergenic
929599133 2:43194182-43194204 GGCCCAAGGTCACCGTGGGAGGG + Intergenic
929655880 2:43731122-43731144 GACTGAGGGAAAGGGTGGGAAGG + Intronic
929753503 2:44742123-44742145 GACTCAGGCTCAGTGAGAGATGG - Intronic
929805117 2:45138346-45138368 GACTCAGGGACAGAGGAGGAAGG + Intergenic
930628282 2:53723481-53723503 GACTCAGGGAAAGGATGGGAAGG - Intronic
932117175 2:69062518-69062540 GAGTCAGGGTGAGCTTGGGCTGG - Intronic
932773476 2:74514273-74514295 GAGCCAGGCTCAGCGCGGGAGGG - Intronic
933771713 2:85748848-85748870 GACTCTTGGTCAGAGTGGAAAGG - Intergenic
934614173 2:95761171-95761193 GACTCAGGGACAGCTGGGGAGGG - Intergenic
934646737 2:96063357-96063379 GACTCAGGGACAGCTGGGGAGGG + Intergenic
934840140 2:97619439-97619461 GACTCAGGGACAGCTGGGGAGGG + Intergenic
936029951 2:109062952-109062974 GGCACAGGGTCAGCGTGGGTGGG - Intergenic
938373734 2:130790521-130790543 GACTCAGGGTCAGGGTGACAGGG + Intergenic
938947863 2:136229868-136229890 GACTCAGGGAAATGGTGGGAGGG + Intergenic
939310665 2:140470850-140470872 GGCTCTGGGTCAGGTTGGGATGG - Intronic
941358455 2:164521356-164521378 GACTCAGGGAAAAGGTGGGAGGG + Intronic
941702613 2:168620264-168620286 GACTCAGGGAAAGGATGGGAAGG + Intronic
945437150 2:209832148-209832170 GACTCAGGGGGAGGGTGGAAAGG + Intronic
946996672 2:225400348-225400370 GAGTCAGGGGCAGGGAGGGAGGG + Intergenic
949050292 2:241894324-241894346 GCCCCAGGCTCCGCGTGGGATGG - Exonic
1170404309 20:16020187-16020209 AGTTCAGGGTCAGGGTGGGATGG - Intronic
1170556380 20:17518403-17518425 GACCCAGGGACAGTGAGGGAGGG + Intronic
1171043854 20:21791998-21792020 GACTCATGGCAAGGGTGGGAAGG + Intergenic
1173184417 20:40829724-40829746 GATTCAGGGACAGGCTGGGATGG - Intergenic
1173415095 20:42847983-42848005 GACTCGGGGAAAGGGTGGGAGGG - Intronic
1175306058 20:57976395-57976417 GACCCAGGGGCAGCCTGGGGTGG - Intergenic
1175402871 20:58710588-58710610 GCTTCAGCGACAGCGTGGGAAGG - Intronic
1175700367 20:61132496-61132518 GACTCAGGGAAAGGGAGGGAGGG - Intergenic
1178429446 21:32506063-32506085 AACTCAGGATCAGAGTGGGGAGG - Intronic
1179454604 21:41490498-41490520 GACTTAGGGACACCATGGGAAGG - Intronic
1179953438 21:44724337-44724359 GGCTCAGGGTCTGTGTGGGTGGG + Intergenic
1181928550 22:26380126-26380148 AAATCAGGGTCAGAGTGGGAGGG + Intronic
1182365477 22:29775948-29775970 GCCTCAGGCTAAGCTTGGGAGGG - Intergenic
1182483383 22:30624697-30624719 GACTCAAGGGCAGAGGGGGAAGG - Intronic
1182812715 22:33131271-33131293 GACTCAGGGACAGAGAGGGATGG - Intergenic
1183161199 22:36114499-36114521 GACCCAGGGCCACCGTGGAATGG - Intergenic
1183508137 22:38220610-38220632 GACCCAGCATCAGCCTGGGAAGG + Exonic
1184264345 22:43339066-43339088 GCCTCAGGGTCTGCCCGGGAGGG + Intronic
1184320890 22:43741428-43741450 GCCTCAGCGGCAGCGTGGGATGG - Intronic
1184418734 22:44367028-44367050 GGCCCAGGGTCAGTGTGGGAGGG - Intergenic
1184516134 22:44963950-44963972 CACTCAGGGTCATCTTTGGAAGG + Intronic
1184810854 22:46830812-46830834 GATTCAGGGTCAGCGTAGGTGGG + Intronic
1184935692 22:47718729-47718751 GACACGGGGACAGGGTGGGAGGG - Intergenic
1185236564 22:49716833-49716855 GACCCAGGGTCAGGAAGGGAGGG + Intergenic
949469680 3:4381328-4381350 GACTCGGGGAAAGGGTGGGAAGG + Intronic
949799671 3:7889957-7889979 GACTCAGGGGGAAGGTGGGAGGG + Intergenic
950066500 3:10115962-10115984 GCCTGAGGGTCAGGGCGGGAGGG - Intronic
950083293 3:10238965-10238987 GGCTGCGGGTCATCGTGGGAAGG + Exonic
950127931 3:10521911-10521933 GACTGAGAGTCAGCGAGGGGAGG + Intronic
952095696 3:29950146-29950168 TACACAGGGTAAGCCTGGGATGG + Intronic
952492271 3:33884063-33884085 GAGGCAGGGTTGGCGTGGGAGGG + Intergenic
952931078 3:38361545-38361567 GACCAAGGGGCAGAGTGGGAGGG + Intronic
954415202 3:50390004-50390026 CTGTCAGGGTCAGGGTGGGAGGG + Intronic
957397530 3:79661352-79661374 GACTCAGGGTCAGCTTCCGAGGG + Intronic
958942195 3:100328920-100328942 GACTCGGGGAAAGAGTGGGAAGG + Intergenic
959394796 3:105823914-105823936 GATTCAGAGTCAGCTTGGTAGGG - Intronic
959906310 3:111714543-111714565 GACTCATGGTCACCATGGAAAGG - Intronic
961525133 3:127492008-127492030 GACTCCGGGCAAGGGTGGGAGGG + Intergenic
964321107 3:155498074-155498096 GACTCATGTCCAGAGTGGGACGG - Intronic
964842109 3:161005469-161005491 ATCTCAAGGTCAGAGTGGGAAGG + Intronic
966373104 3:179268765-179268787 GCCTCTGGGTCAGATTGGGAGGG - Intergenic
968446635 4:655454-655476 AAGTCAGGGTCAGGGTGGCAGGG + Intronic
968957069 4:3724961-3724983 TACTCAGGGTCCGCGGGGAAGGG + Intergenic
969824256 4:9744418-9744440 AACTCAGGATCAGAGTGGGGAGG - Intergenic
973933136 4:55813809-55813831 GACTCAGGGAAATGGTGGGAGGG + Intergenic
979584386 4:122398151-122398173 GACTCTGGGGCACCGGGGGAAGG - Intronic
979852005 4:125583417-125583439 GACTCAGGGTCAAGCTGGAAGGG - Intergenic
981168978 4:141599088-141599110 GACTCAGGAAAAGAGTGGGAGGG + Intergenic
982000080 4:151014664-151014686 AACTCAGAGTCACCCTGGGACGG + Exonic
985257903 4:188087706-188087728 GACACAGGGTCTGGGTTGGAAGG + Intergenic
985619302 5:945548-945570 CTCTCAGGGTCAGCGTGGCCAGG - Intergenic
985956973 5:3272940-3272962 GATTCAGGGTCTGTGTGAGAAGG - Intergenic
987788552 5:22534350-22534372 GACTCAGGGGAAGTGTGGGAAGG - Intronic
988108276 5:26778901-26778923 ACCTCAGAGTCAGCGTAGGAGGG + Intergenic
989626912 5:43438421-43438443 GCCTAAGGGTCAGAGTGGGAAGG + Intergenic
989723585 5:44559573-44559595 GACTCAGGGAGAGGGTGGAAGGG + Intergenic
989975370 5:50579713-50579735 GACTCAGGGGAAATGTGGGAGGG - Intergenic
993309571 5:86312932-86312954 GACTCAGAATCATGGTGGGAAGG - Intergenic
993404859 5:87499294-87499316 GACACAGGATCAGGGTGGGGCGG - Intergenic
993704993 5:91159840-91159862 GACTCAGGATGAGGGTAGGATGG + Intronic
994603083 5:101932770-101932792 GACTCAGTGTCATTGTGGAAAGG + Intergenic
997205613 5:132047315-132047337 GACTAGGGGTCAGGGTGGGGAGG + Intergenic
999428565 5:151507189-151507211 GGCTCATTGTCAGAGTGGGAAGG + Exonic
999593221 5:153172089-153172111 GACTCAGGGAAAGAGTGGAAGGG - Intergenic
999721081 5:154399785-154399807 GACTCAGGGCCAGTGTTGGCAGG - Intronic
1000910721 5:167018892-167018914 GCCTCAGAGTCAGCCAGGGAAGG - Intergenic
1001035890 5:168295957-168295979 GAGTCAAGGCCAGCCTGGGAAGG + Intronic
1002337919 5:178493268-178493290 GACTGAGGTTCAGTGTGGGCTGG - Intronic
1003260389 6:4511125-4511147 AACTCAGGGACTGTGTGGGAGGG + Intergenic
1003441542 6:6147152-6147174 GACTCAGGGGAAAGGTGGGAGGG + Intronic
1006149849 6:31981123-31981145 GAGACAGGGTCACCTTGGGAAGG + Exonic
1006156150 6:32013861-32013883 GAGACAGGGTCACCTTGGGAAGG + Intergenic
1006341288 6:33448564-33448586 GTCTGAGGGCCAGAGTGGGAGGG - Intronic
1006969895 6:38031840-38031862 GACCCTGGGACAGCGTGGGGCGG - Intronic
1007299780 6:40858178-40858200 GACTCAGGGGAAAGGTGGGAAGG - Intergenic
1011618843 6:89223199-89223221 GACTCGGGGAAAGGGTGGGAAGG - Intronic
1012542375 6:100376278-100376300 GACTCAGGCTCAGGGGAGGAGGG - Intergenic
1012582633 6:100887685-100887707 GACTCAGGGAAAGGGTGGGAAGG + Intergenic
1014096624 6:117468467-117468489 GACTCGGGGGAAGGGTGGGAGGG - Intronic
1016225741 6:141734263-141734285 GAATATGGGACAGCGTGGGATGG + Intergenic
1016242979 6:141953438-141953460 GACTCAATGTCAGCCTGTGAAGG + Intergenic
1018226039 6:161629610-161629632 GGTTCAGGGCCAGCCTGGGAAGG - Intronic
1018420411 6:163635977-163635999 GAGGCAGGGTCGGTGTGGGACGG + Intergenic
1019092882 6:169554252-169554274 GACTCAGCGGCTGGGTGGGACGG + Intronic
1020388364 7:7632172-7632194 CACTCAGTGTCAGCCTGTGAAGG + Intergenic
1022479051 7:30731192-30731214 GACTGAGGCTCAGAGAGGGAGGG - Intronic
1023397226 7:39762537-39762559 GAGCCAGGGTCAGCGTGAGTTGG + Intergenic
1024074903 7:45813342-45813364 GGCAAGGGGTCAGCGTGGGAGGG - Intergenic
1024074924 7:45813424-45813446 GGCAAGGGGTCAGCGTGGGAGGG - Intergenic
1024075024 7:45813816-45813838 GGCAAGGGGTCAGCGTGGGAGGG - Intergenic
1025052469 7:55742186-55742208 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025052790 7:55743460-55743482 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025052801 7:55743493-55743515 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025052822 7:55743559-55743581 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025052833 7:55743592-55743614 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025052844 7:55743625-55743647 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025129396 7:56367739-56367761 GCCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025129468 7:56368015-56368037 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025129499 7:56368141-56368163 GCCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025129561 7:56368367-56368389 GGCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025129681 7:56368870-56368892 GCCAAGGGGTCAGCGTGGGAGGG + Intergenic
1025135445 7:56407929-56407951 GAGCCAGGGTCAGCGTGAGTTGG - Intergenic
1026103242 7:67399871-67399893 GACTCGGGGAAAGAGTGGGAAGG - Intergenic
1026269890 7:68827161-68827183 GACTCAGGGGAAGGGTGAGAAGG - Intergenic
1026598161 7:71751848-71751870 GACTCAGGGGCAGCATGTGCAGG + Intergenic
1028557193 7:92136752-92136774 GACTCAGGGAAAGGGTGGAAGGG + Intronic
1029529792 7:101117637-101117659 GACCCAAGGTCAGTGGGGGATGG - Intergenic
1031088370 7:117324504-117324526 GTATCTGGGTCAGCCTGGGAGGG - Intergenic
1031740467 7:125423370-125423392 GACTCGGGGAAAGGGTGGGAAGG + Intergenic
1032471805 7:132184377-132184399 GTAACAGGGGCAGCGTGGGAAGG - Intronic
1033310417 7:140257668-140257690 GACTCAGGGAAAGAGTAGGAAGG + Intergenic
1034702372 7:153107738-153107760 GACATAGGATCAGGGTGGGATGG + Intergenic
1035458397 7:159024095-159024117 GAGTGAGGGTCAGGGTGGGGTGG - Intergenic
1036616724 8:10393481-10393503 GACACAGCGTCAGCATGTGACGG + Intronic
1036657936 8:10690003-10690025 GACTCTGGGACAACGTGGGTTGG - Intronic
1037864940 8:22436050-22436072 GAGTCAGGGTCAGGCTGGGAAGG + Intergenic
1040370251 8:46763649-46763671 GACTCGGGGGAAGGGTGGGAGGG + Intergenic
1040421107 8:47241299-47241321 GGGTCAGGGTCAGAGTGGGGGGG + Intergenic
1042225804 8:66513477-66513499 CAGTCAGGGCCAGAGTGGGAAGG + Intronic
1044221840 8:89678587-89678609 GACCCAGGGCCACCGTGGCATGG - Intergenic
1046604640 8:116357564-116357586 GAGTCAGGGTGAAAGTGGGAAGG - Intergenic
1046761399 8:118025122-118025144 TACTGGGGGTCAGAGTGGGAAGG + Intronic
1047109748 8:121776348-121776370 GATTCACGTTCAGGGTGGGATGG - Intergenic
1047405193 8:124579334-124579356 TTGTCAGGGTCAGCGTGGGTGGG + Intronic
1047759257 8:127942017-127942039 GACTCAGGGTGCCCTTGGGAAGG - Intergenic
1048364324 8:133725194-133725216 AGCCCAGGGTCAGTGTGGGAAGG - Intergenic
1048375470 8:133818924-133818946 GTCTCAGGGTCAGCTTGGGGTGG + Intergenic
1049413995 8:142487207-142487229 GACACAGGGTCATCGAGGGGCGG - Intronic
1049731237 8:144179614-144179636 GACTCAGGCCTAGCTTGGGAAGG + Intronic
1050435957 9:5611011-5611033 GACTCAGAGGAAGAGTGGGAAGG - Intergenic
1051126533 9:13811603-13811625 GAGTCAGGGTCAGGGTGGGAGGG - Intergenic
1053347781 9:37390533-37390555 GGCCCAGAGTCAGAGTGGGAGGG + Intergenic
1056543697 9:87595620-87595642 GACCCAAGGCCAGCGTGGGTCGG - Intronic
1056555846 9:87686473-87686495 ACCTCAGGGCCAGCCTGGGAGGG + Intronic
1056668763 9:88604968-88604990 GACTCAGGGTTATTTTGGGAAGG + Intergenic
1056936506 9:90919130-90919152 GAATCAGGGTCACCATGGGCTGG - Intergenic
1057302560 9:93895301-93895323 AACTGAGGCTCAGCTTGGGAAGG + Intergenic
1057871433 9:98721130-98721152 GCCTCAGAGTCAGGGTGGGACGG - Intergenic
1059733842 9:117082394-117082416 CACTCTGGGTGAGCATGGGAAGG - Intronic
1060810685 9:126610179-126610201 GGCGCCGGGACAGCGTGGGACGG + Intergenic
1061235751 9:129341683-129341705 GACTTAGGGTCACCGTCGGCTGG - Intergenic
1061537516 9:131259053-131259075 GTCTCCGTGACAGCGTGGGACGG - Exonic
1061957590 9:133971653-133971675 GGGTCAAGGCCAGCGTGGGAAGG + Intronic
1062243093 9:135550164-135550186 ATCTCAGGCTCAGCTTGGGACGG + Intergenic
1185807348 X:3070726-3070748 GACTCAGGGAAAGGGTGGGAGGG - Intronic
1185827565 X:3266663-3266685 GACTGAGGGAAAGGGTGGGAAGG - Intergenic
1185937452 X:4274954-4274976 GACTCGGGGGAAGAGTGGGAGGG - Intergenic
1185955325 X:4482832-4482854 GACTCGGGGAAAGGGTGGGAGGG + Intergenic
1185978242 X:4745867-4745889 GACTCGGGGGAAGGGTGGGAGGG + Intergenic
1186457569 X:9722061-9722083 GAGACAGGGTCAGCGGGGCACGG - Intergenic
1187716027 X:22103454-22103476 GACTCAGGGGGAGAGTGGGAGGG - Intronic
1189202558 X:39210109-39210131 GACTCATGGTCACAGTGGGAGGG - Intergenic
1189559936 X:42182059-42182081 GGCTCAGGGTCAGCGTGAGGAGG + Intergenic
1189568670 X:42271999-42272021 GACTCAGTGTCAACCAGGGATGG + Intergenic
1190259646 X:48789955-48789977 GAGTCTGGGTGAGGGTGGGATGG - Intronic
1191100835 X:56726403-56726425 GACTCAGGGAACGGGTGGGAGGG + Intergenic
1192244344 X:69360415-69360437 GACTCAGGTTGAGAGTGGGTGGG + Intergenic
1192436703 X:71147767-71147789 GGCTCAGGGACAGCGAGGGCGGG - Exonic
1192984980 X:76388437-76388459 GACTCGGGGTAAGAATGGGATGG - Intergenic
1193659376 X:84238343-84238365 GACTCAGGGGAAGGATGGGAGGG + Intergenic
1194634249 X:96324222-96324244 GACTCGGGGAAAGAGTGGGAGGG + Intergenic
1195057082 X:101156650-101156672 GACTCGGGGAAAGGGTGGGAAGG - Intronic
1195709081 X:107759869-107759891 GCCTCAGGGCCAGCCTGGGCTGG + Intronic