ID: 1070481149

View in Genome Browser
Species Human (GRCh38)
Location 10:76884060-76884082
Sequence TATTGTGATGGGAATGGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070481149_1070481155 24 Left 1070481149 10:76884060-76884082 CCCATTCCATTCCCATCACAATA 0: 1
1: 0
2: 2
3: 31
4: 285
Right 1070481155 10:76884107-76884129 ACTGTATATAAAACGCACTTCGG 0: 1
1: 0
2: 1
3: 16
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070481149 Original CRISPR TATTGTGATGGGAATGGAAT GGG (reversed) Intronic
902116079 1:14122461-14122483 GATTGTGATGGGAATGAAATGGG - Intergenic
902878576 1:19355838-19355860 TCTTGGGATGGGAATGTAAAGGG + Intronic
903413543 1:23166912-23166934 TAGTGAGCTGGGAAGGGAATGGG - Intronic
904886444 1:33742192-33742214 AGTGGTGAGGGGAATGGAATGGG + Intronic
904932533 1:34101050-34101072 GATTGAAATGTGAATGGAATGGG + Intronic
907455217 1:54571358-54571380 TATGGGGATGGGAGTGGAATTGG + Intronic
909214627 1:72870399-72870421 AGTTGGGATTGGAATGGAATGGG + Intergenic
909556777 1:76962968-76962990 TATTGGTATGGAGATGGAATTGG + Intronic
910081596 1:83348313-83348335 GAGTGTGATGGGAATGGAAATGG + Intergenic
910230940 1:84985885-84985907 TATTTTGATGGGAATTGCATTGG - Intronic
911058322 1:93726452-93726474 GATTGTGAGGGGAATTGCATTGG + Intronic
911300046 1:96161407-96161429 TATTGAGATGAGGAAGGAATGGG + Intergenic
912670259 1:111618793-111618815 CATTTTGATTGGAATGGATTTGG - Intronic
915020589 1:152775313-152775335 AATTGTGATTGGCAAGGAATGGG + Intronic
915295221 1:154916199-154916221 TATTTTGATGGTATTGTAATTGG + Intergenic
915604271 1:156940948-156940970 TACTGTGATGGGATTGGTAGAGG - Intronic
917365605 1:174229040-174229062 CATTATGATGGGGATGGAATTGG + Intronic
917440960 1:175068558-175068580 TATTGTGAGGGTAATAGTATGGG - Intronic
918101363 1:181378048-181378070 TATAGTGATGGTAATAGAAATGG + Intergenic
918684911 1:187402281-187402303 AATTGTGTTTGCAATGGAATGGG - Intergenic
919517092 1:198539314-198539336 TGTAGTGATGGGATTGGAGTAGG - Intronic
920775612 1:208934022-208934044 TAGAAGGATGGGAATGGAATGGG - Intergenic
921151216 1:212404573-212404595 TATAGAGATGGGAATAAAATAGG - Intronic
921263924 1:213406744-213406766 TATTGTGATGGGGATGACTTAGG + Intergenic
921717535 1:218433566-218433588 TATTTTAATGGCAATGGATTTGG + Intronic
922385438 1:225076342-225076364 TACTGTGATGGGCCTGGTATTGG + Intronic
1067180070 10:43978686-43978708 TACTGTAATAGGAATGAAATAGG + Intergenic
1067429601 10:46234379-46234401 CACTGTGATGGCATTGGAATTGG + Intergenic
1067742645 10:48907589-48907611 TATTCTCATGGGAATCGCATAGG - Intronic
1068122447 10:52796814-52796836 TATTTTGATGGGAATTGCATTGG + Intergenic
1069083322 10:64111624-64111646 TTTTGTGATAGGAATAGACTAGG + Intergenic
1069290307 10:66770725-66770747 AATTGTGATGGGAAGGGGAATGG + Intronic
1069447756 10:68489600-68489622 TATTGTGATGTTTATTGAATTGG + Intronic
1070481149 10:76884060-76884082 TATTGTGATGGGAATGGAATGGG - Intronic
1070839717 10:79475715-79475737 TATTGAGAAGGGAGAGGAATTGG - Intergenic
1071058447 10:81540046-81540068 TATTTTGATTGGAATTGCATTGG - Intergenic
1071146554 10:82581048-82581070 CATTGTGGTGGGAATGTAAATGG - Intronic
1073028619 10:100507184-100507206 TCCAGAGATGGGAATGGAATGGG - Intronic
1073329375 10:102660757-102660779 CATTCTGGTGGGAATGGGATGGG + Intergenic
1073668869 10:105564828-105564850 GGTTATCATGGGAATGGAATTGG - Intergenic
1075575708 10:123576009-123576031 TAGTGGGATGTGAATGGAAGTGG - Intergenic
1075929822 10:126286334-126286356 AGTTGTGATGGGAGTGGACTTGG - Intronic
1076279931 10:129237798-129237820 TAATATTATGGGAGTGGAATGGG - Intergenic
1077924292 11:6665142-6665164 TATTGTGATACAAATGGAACTGG - Intergenic
1078576016 11:12503405-12503427 TATGGTGATTGGAGTGGAGTGGG + Intronic
1079118984 11:17664406-17664428 GCTTGGGATGAGAATGGAATTGG + Intergenic
1079188783 11:18260490-18260512 TTTTGTAATGGGAAGGAAATAGG - Intergenic
1079620924 11:22552841-22552863 TATGGTGGTGGGATGGGAATGGG + Intergenic
1080313165 11:30918497-30918519 TATTGTAATGGAAATTGACTGGG + Intronic
1080839628 11:35971881-35971903 TATTGGGATGGGGAAGGAGTGGG + Intronic
1080854305 11:36098544-36098566 TATTGTGTTTGGAATGGGAATGG - Intronic
1081241648 11:40713881-40713903 TATAGCGATGGGAATTGAAGAGG - Intronic
1081416839 11:42825809-42825831 TATAGTGAAGGGAGGGGAATGGG + Intergenic
1085043446 11:73340220-73340242 TATTGTCTTGGCAATGGAGTGGG - Intronic
1087069610 11:94064776-94064798 TATTGTAATTGGAAAAGAATCGG + Intronic
1088961351 11:114668974-114668996 TATAGAGCTGGGAGTGGAATGGG - Intergenic
1090637731 11:128701939-128701961 TGATGTTATGGGAAAGGAATCGG + Intronic
1090938310 11:131365223-131365245 ACTTTGGATGGGAATGGAATGGG - Intergenic
1092191952 12:6527758-6527780 TATTCTAAAGGGAATGAAATTGG - Exonic
1092708552 12:11309804-11309826 CAATGTGCTGGGAGTGGAATGGG - Intronic
1093406169 12:18807429-18807451 TATTGTGTGGGCAATGGAGTTGG + Intergenic
1095130505 12:38536727-38536749 TAGTTTGATGGGAATAGCATTGG - Intergenic
1095286382 12:40415911-40415933 GATTTTGATGGAAATGGAGTAGG + Intronic
1095517365 12:43021341-43021363 TATGGTGAGGGCAATGGATTAGG + Intergenic
1097581723 12:61465399-61465421 TATTTTGATGGGAATTGCTTTGG - Intergenic
1097714300 12:62949539-62949561 TATTTTGATAGGAATAGCATTGG + Intergenic
1097841621 12:64326998-64327020 TGTTATCATGGGAATGGAACTGG + Intronic
1097873571 12:64622486-64622508 AATTGCGATGAGAAAGGAATCGG + Intronic
1098982303 12:76970092-76970114 TATTTTGATAGGAATTGCATTGG + Intergenic
1099630958 12:85144858-85144880 TAAAGTGATGGCAATGGAAAAGG - Intronic
1099809883 12:87567617-87567639 TATTTTGATGGGCAGGGGATAGG + Intergenic
1101965823 12:109281369-109281391 TGGAGTGATGGGAATGGAATGGG - Intronic
1105068181 12:133217720-133217742 CATTGTGATAGGGAGGGAATGGG - Intergenic
1106353616 13:28957911-28957933 TTTTGTGATAGGCATGGGATAGG + Intronic
1106651832 13:31699478-31699500 TTTTTTGATGGTGATGGAATGGG + Intergenic
1106829387 13:33563172-33563194 TATTTTGATAGGGATTGAATTGG - Intergenic
1107495581 13:40922566-40922588 CATTGCGCTGGGAATGGAAAAGG + Intergenic
1107704688 13:43089581-43089603 TAGTGTGATAGGAATGTAATAGG + Intronic
1108345952 13:49547145-49547167 TATTGTGATTGGAAAATAATTGG - Intronic
1108785638 13:53898134-53898156 TAGCTTGATGGGAATGGCATTGG - Intergenic
1110803568 13:79728714-79728736 TAGTGTGATAGGAATTGCATTGG + Intergenic
1110954147 13:81532764-81532786 AATTGTAGTGGGAATGGGATGGG - Intergenic
1112105298 13:96233309-96233331 TCTTGTCATGGCTATGGAATGGG + Intronic
1112896485 13:104305953-104305975 TATTGTGGAAGGAATGAAATGGG - Intergenic
1114281919 14:21200939-21200961 ATTTGTGATGGGTATGTAATGGG - Intergenic
1114339254 14:21725843-21725865 GCTTGTGAGGGGAATGGAAAGGG + Intergenic
1116177830 14:41495686-41495708 TATTTTGATGGGAATAGCATTGG - Intergenic
1117323562 14:54647805-54647827 TTTTGTTGTGGGAATTGAATAGG + Intronic
1117362285 14:54988086-54988108 AATTATGATGGGAAAGCAATGGG - Intronic
1117980902 14:61341000-61341022 TATTGTGATGGCCTTGGAACTGG + Intronic
1118110952 14:62719186-62719208 TATTGTGAATTGTATGGAATGGG + Intronic
1118429438 14:65701934-65701956 TAATGGAGTGGGAATGGAATAGG + Intronic
1118731417 14:68669670-68669692 GATTGTGATGGGAATGCAATGGG - Intronic
1119364810 14:74082920-74082942 CATTGTGATGGGAGGGGAAGAGG + Intronic
1121482907 14:94292156-94292178 CATTGTGATGGCAATAGAGTTGG + Intronic
1121595787 14:95161148-95161170 TTGTGTGATTGGATTGGAATTGG + Intergenic
1122286501 14:100655536-100655558 TATTGTGCTGGGACTGGAGCTGG + Intergenic
1127128563 15:55837551-55837573 TAAAGTGAAGAGAATGGAATAGG + Intronic
1129049738 15:72770498-72770520 GATTCTGATGGGAATGGCCTGGG + Intronic
1130243002 15:82214753-82214775 TCTTCTGATGGGAAGGGAACTGG - Exonic
1130457446 15:84126542-84126564 TCTTCTGATGGGAAGGGAACTGG + Intergenic
1130686615 15:86043095-86043117 TTTTTGGATGCGAATGGAATGGG + Intergenic
1131175982 15:90210091-90210113 GATGGTGAGGGGAATGGATTTGG + Intronic
1131725885 15:95224194-95224216 TACTGTGGTGGGACTGGTATTGG + Intergenic
1132010371 15:98269807-98269829 CATGTTGATGGGAATGGAAGAGG - Intergenic
1132612688 16:825122-825144 CTTTGTGACGCGAATGGAATCGG - Intergenic
1133026797 16:2992114-2992136 TCTGGTGATGGGAATGGGATGGG + Intergenic
1133198201 16:4185435-4185457 TATTGGGATGGGTACGAAATTGG + Intergenic
1134536211 16:15028786-15028808 TATTGGGATGGGAATGATGTGGG + Intronic
1134937832 16:18261819-18261841 TATTGTGGTGGGATAGGGATGGG - Intergenic
1136106086 16:28031158-28031180 GGTTGAGATGGGAATGGGATGGG + Intronic
1139859853 16:70012001-70012023 TATTGGGATGGGAATGATGTGGG - Intergenic
1140019340 16:71222916-71222938 TATTTTGATGGGAATCGCTTTGG - Intronic
1144406057 17:14953726-14953748 TAGTGTGATGGGAAAGGAGGCGG + Intergenic
1144432768 17:15210239-15210261 AATTGTGACTGGAAAGGAATAGG - Intergenic
1144785982 17:17831858-17831880 TCTTGTCATGTGAATGGATTTGG - Intronic
1147057438 17:37845192-37845214 TATTGTGATTGCAATGGAAACGG + Intergenic
1149853016 17:60052641-60052663 AATTGTGAAGGGAAAAGAATAGG + Intronic
1151206863 17:72514226-72514248 TACTGTCATGGGAATAGCATAGG - Intergenic
1152104087 17:78318816-78318838 AAGTGTGCTGGGATTGGAATGGG + Intergenic
1153772906 18:8429550-8429572 TATAATGATGGGTCTGGAATGGG - Intergenic
1154359901 18:13651470-13651492 TATTATGATGGGACATGAATGGG - Exonic
1156498673 18:37543216-37543238 TCTCGGGATGGGAATGAAATGGG - Intronic
1157031602 18:43916991-43917013 TATTGTGATGTTAAGGGAAATGG - Intergenic
1157796457 18:50579774-50579796 AACTGTGATGGGCATGGAGTGGG - Intronic
1157817588 18:50741345-50741367 TACTGTGGTGGGAATGGGAGGGG - Intergenic
1158248808 18:55463419-55463441 TAATGTAATAGGAATGTAATAGG - Intronic
1164157922 19:22607669-22607691 CAGGGTGATGGGAATGGAAATGG + Intergenic
1165376617 19:35447504-35447526 TGTTGTGATGGAAATGGTGTGGG - Intronic
1166416561 19:42599415-42599437 TATTTTGATGGGAATTGCATTGG + Intronic
926616153 2:14998621-14998643 AACTGTGAAGGGAAGGGAATGGG - Intergenic
927996454 2:27490395-27490417 TATTGGGATGGGAATGTGACAGG - Intergenic
928034349 2:27807747-27807769 GGTTGTGATTGGAATGGAAAAGG + Intronic
928621252 2:33090529-33090551 CATTGTGATGAGAATGAAATGGG - Intronic
928679110 2:33680790-33680812 AGTGGTGATGGGAATGGAAATGG + Intergenic
929197457 2:39200431-39200453 TATTTTGATGGGAATTGCATTGG - Intronic
929218871 2:39442967-39442989 TATTATCATGAGAATGGCATGGG - Intergenic
930243465 2:48959520-48959542 TTTGGTGAAGGGGATGGAATGGG - Intergenic
931056368 2:58476525-58476547 TAATGAGATGGAAATGCAATAGG + Intergenic
931497532 2:62825955-62825977 TTGTGTGATAGGAATGTAATAGG + Intronic
932590002 2:73059517-73059539 TATTGGGAAGGGAAAGGAACAGG - Intronic
933250872 2:80027207-80027229 TAGTGGTATGGGAATGGCATGGG + Intronic
936714383 2:115168113-115168135 TATGGGGAGGGGCATGGAATTGG + Intronic
936907727 2:117556406-117556428 TGTGCTGATGGGAATGGTATTGG - Intergenic
937702469 2:124879494-124879516 TAGTGAGATGGGAAATGAATGGG + Intronic
939425450 2:142030662-142030684 ATTTGTGTTGGGGATGGAATGGG + Intronic
940172003 2:150838934-150838956 TATTTTGATGGGGATTGCATTGG + Intergenic
942959031 2:181807491-181807513 GTTTGTGATGGGAATAGAACAGG + Intergenic
943940592 2:193989244-193989266 TATAATGATGGGACAGGAATAGG - Intergenic
944603376 2:201326767-201326789 TATTTTGATGGGAATTGCACTGG - Intronic
945499817 2:210557942-210557964 GATAGGGATGGGAAAGGAATGGG + Intronic
946282454 2:218675996-218676018 TAATGGGATGGAAATGGAAAGGG - Intronic
948249440 2:236513872-236513894 TATTGTGATTGGCATAGTATGGG - Intergenic
948568740 2:238903219-238903241 TTATGTGATGGGTGTGGAATGGG + Intronic
1168868140 20:1106365-1106387 TATTGTGAGGAGGATGAAATGGG - Intergenic
1170393763 20:15903782-15903804 TATTGTGTTGAGAATAGACTGGG + Intronic
1172573787 20:35991121-35991143 TATTGGGAAGAGAATGGATTGGG + Intronic
1173289463 20:41701754-41701776 CTTGGTGATGGGAATGGAGTAGG - Intergenic
1175360128 20:58403264-58403286 TTAAGTGATGGGAAAGGAATGGG - Intronic
1175559934 20:59915661-59915683 TTTTATTATGGGAATGGAGTAGG + Intronic
1176694191 21:9954249-9954271 TATTTTGATAGGAATTGCATTGG + Intergenic
1177174076 21:17685086-17685108 TATTTTGATGGGGATTGCATTGG + Intergenic
1178062535 21:28867868-28867890 TATTTTTATGACAATGGAATGGG - Intergenic
1178743350 21:35224138-35224160 TATTGAGAAGGGAATTGTATTGG - Intronic
1181307817 22:21926963-21926985 CATTGTGGTGGGAATGACATGGG + Intronic
1182882331 22:33744427-33744449 CTCTGTGATGGGAATGGAATGGG + Intronic
1183248749 22:36713372-36713394 TTTTGTCATGGGGATTGAATGGG + Intergenic
1184013743 22:41769791-41769813 CATTGTTATGGGAATGCAATGGG + Intronic
1185251979 22:49807221-49807243 TATTTTGATAGGAATTGCATTGG - Intronic
949215048 3:1556719-1556741 TAATATGATGGCAATGGAGTGGG + Intergenic
949373996 3:3366633-3366655 CATGGTGATGGGAAGGGAAGAGG + Intergenic
950583281 3:13876864-13876886 GATTGTGATGGGAATTTATTAGG - Intronic
951241121 3:20287477-20287499 TATAGTGATGGTACTGGCATTGG + Intergenic
952279074 3:31905654-31905676 TATTGTGATGAGAATTCACTAGG - Intronic
953848330 3:46446195-46446217 TTTTGTCATGGTCATGGAATGGG - Intronic
954140962 3:48605161-48605183 TACAGTCATGGGAATGGCATGGG - Intronic
955294419 3:57722142-57722164 TAATGTGATGGCAATGGGAATGG - Intergenic
955641383 3:61089188-61089210 TATTGAGCTGGGAATGGACCTGG - Intronic
956457672 3:69439490-69439512 TCGTGAGATGGGGATGGAATGGG + Intronic
957340752 3:78893035-78893057 CAGTGTGATGGCAATGGGATGGG - Intronic
959632603 3:108524995-108525017 TAATGTGATGTGAATGGAAAAGG - Intronic
959778494 3:110199826-110199848 TAGTGTGGTGGCAATGGGATCGG - Intergenic
960439827 3:117673145-117673167 TAGTGGAATGGTAATGGAATTGG - Intergenic
962486800 3:135851587-135851609 TTTGGTGATGGGAATGGATAAGG + Intergenic
963110936 3:141687292-141687314 ACACGTGATGGGAATGGAATAGG - Intergenic
963156722 3:142106823-142106845 AATTGTGATTGGAATGGGAAAGG - Intronic
963384802 3:144578124-144578146 CATTGTGTGGGGACTGGAATAGG + Intergenic
964175251 3:153820203-153820225 GTTTGTGATGGGAGTGGAGTGGG - Intergenic
965102066 3:164310670-164310692 CACTGTCATGAGAATGGAATGGG + Intergenic
965296285 3:166951104-166951126 TATTTTGATGGGGATTGCATTGG + Intergenic
966153773 3:176893638-176893660 TATTTTGATGGGAATTGCATTGG - Intergenic
966460581 3:180171702-180171724 TGTTGTTATGGGAAAGGTATTGG - Intergenic
966561044 3:181320799-181320821 TAGTTTGATGGGAATAGCATTGG + Intergenic
966703983 3:182890298-182890320 TTAAGTGATGGGAATGGAAAAGG - Intronic
967227423 3:187305447-187305469 TATTATGAGGAGAATGGACTTGG + Intergenic
971886192 4:32451420-32451442 TATTGTAATGGGAAAACAATAGG - Intergenic
972157152 4:36178512-36178534 TACTGTGGTGAGAGTGGAATGGG - Intronic
972352862 4:38253023-38253045 CTTTGTGATGGGAATATAATGGG - Intergenic
972740188 4:41880961-41880983 AAGGGAGATGGGAATGGAATGGG - Intergenic
973747527 4:53978376-53978398 TCTTGTTTTGGGAATGGGATTGG + Intronic
974993089 4:69117523-69117545 TATTTTAATGAGAATTGAATTGG - Intronic
974998245 4:69190386-69190408 TGTTTTGATGAGAATTGAATTGG + Intronic
976513185 4:85933970-85933992 TAAGGTGATGGAAATGGAAATGG - Intronic
977351152 4:95889571-95889593 TATTGTGATGTGAAGGGTATTGG - Intergenic
977690446 4:99902319-99902341 TCATGGGATGGGAATGGAAAGGG - Intronic
977856395 4:101900007-101900029 TGTTGTTATGGTAATGGAATTGG - Intronic
978728095 4:111994166-111994188 TAATGTGATGAGAATAGCATAGG - Intergenic
978784108 4:112590519-112590541 GCTTTTGATGGGAGTGGAATTGG + Intronic
978863755 4:113482237-113482259 TAGAGTGATGGCAATGGAGTTGG + Intronic
979160594 4:117455729-117455751 TACAGTGATGGGTATGGAACTGG + Intergenic
979785088 4:124707200-124707222 TATTTTGAGGGAAATGGAAATGG - Intronic
980419456 4:132541531-132541553 TATTGAGAAGGGTATGGAAGTGG - Intergenic
981927209 4:150153204-150153226 TATGGGGGTGGGGATGGAATTGG + Intronic
982448482 4:155523354-155523376 AAATGTCATGGTAATGGAATAGG - Intergenic
982510560 4:156276939-156276961 GACAGTGATAGGAATGGAATTGG + Intergenic
982825349 4:159997540-159997562 TATTGTTATGGCAGAGGAATGGG - Intergenic
983433055 4:167675611-167675633 TATTGTCTTGAGAAGGGAATAGG - Intergenic
984080570 4:175244608-175244630 TATTGTGAAGAAAATGGATTTGG - Intergenic
984492099 4:180447134-180447156 TGTAGAGATGGGAATGGAACAGG + Intergenic
984786176 4:183569395-183569417 TGGTGTGATGGGAGTGGATTGGG - Intergenic
985115558 4:186586549-186586571 GATTGTGATGGGAAGGGACGGGG - Intergenic
985184345 4:187299555-187299577 TGTTGTTATGGAAATGGCATAGG - Intergenic
987078606 5:14406352-14406374 TATGGTGATGGGAATCCAACAGG + Intronic
987515946 5:18907998-18908020 TATCATGACAGGAATGGAATGGG + Intergenic
988805145 5:34733490-34733512 CATTGTGATGGGACAGGAAAAGG - Intronic
989031985 5:37128547-37128569 TATTTTGATAGGAATTGCATTGG - Intronic
989326368 5:40200832-40200854 TAGTGTAATGGTAATGGTATGGG - Intergenic
989562932 5:42872008-42872030 TATTGTGATGGGAGTAGATGCGG - Intronic
991400657 5:66247753-66247775 TAGTGTGGTGGGAATGACATGGG - Intergenic
991674523 5:69077613-69077635 TATTGTACTGGGAATGTGATAGG - Intergenic
992829666 5:80582052-80582074 TAGCTTGATGGGAATGGCATTGG + Intergenic
992909292 5:81379578-81379600 TTTCCTGATGGGAATGAAATGGG - Intronic
992971370 5:82062257-82062279 AGTTGTCACGGGAATGGAATCGG + Intronic
996129326 5:119762547-119762569 TTTTGAGCTTGGAATGGAATTGG + Intergenic
996474095 5:123895661-123895683 TATTGTCATGGGTATAGAACAGG + Intergenic
996628637 5:125600989-125601011 TAAAGTGATGAGAATGCAATGGG + Intergenic
996763492 5:127010601-127010623 TAGTGTGTTGGGAAAGGGATTGG - Intronic
997696271 5:135863608-135863630 TGCTGTGATGATAATGGAATGGG - Intronic
997986082 5:138502589-138502611 TTTAGTGAGGGGATTGGAATAGG + Intergenic
999030538 5:148285737-148285759 TATTGAGATGGGAATGGGTTAGG + Intronic
1000283157 5:159800036-159800058 TATTCTGAATGGAATGGAAATGG - Intergenic
1002913403 6:1508734-1508756 TAAGCTGATGGGAATGGAAAAGG + Intergenic
1002918582 6:1548775-1548797 TAAGCTGATGGGAATGGAAAAGG - Intergenic
1003331865 6:5135572-5135594 GATTTTCATGGGAATGGAACTGG + Intronic
1003787790 6:9506403-9506425 TCTTGTGATGGAGATGGAAAAGG + Intergenic
1004201377 6:13551241-13551263 TATTGTGTTGGGAATATACTGGG + Intergenic
1004667367 6:17760952-17760974 TCTTGTGATGGGTGTGGACTGGG - Intronic
1004957736 6:20748765-20748787 TATGGTGTTGGGAATGAAACTGG + Intronic
1006343076 6:33457635-33457657 TATGTTGATGGGGAAGGAATGGG + Intergenic
1007598359 6:43065927-43065949 TACTGAGATGGAAATGGCATAGG + Intronic
1007891285 6:45294940-45294962 TATTTTCATGGGAATTGCATTGG - Intronic
1008791701 6:55242588-55242610 TATTGTGATGTGATTGGATATGG - Intronic
1009779552 6:68252453-68252475 TACTTTGATGGGAATTGCATTGG + Intergenic
1010369661 6:75092776-75092798 AAATCTGATGGGAATGGGATGGG - Intronic
1012178404 6:96119806-96119828 CATTGTGATTGGAAAGCAATAGG - Intronic
1012679962 6:102167907-102167929 TAGTTTGATGGGAATAGCATTGG - Intergenic
1012865793 6:104616481-104616503 TATTGTTATGGGATTGTATTAGG - Intergenic
1013381463 6:109576218-109576240 TATTTTGATGGGAATTGCATTGG + Intronic
1013686114 6:112585123-112585145 TATTTTGATGGGGATTGCATTGG + Intergenic
1014758423 6:125327669-125327691 TATGGGGATGGGAATGGAAGTGG - Intergenic
1015013408 6:128379377-128379399 TATTGTGTTGGTAATGTAAATGG - Intronic
1015136565 6:129878823-129878845 TAGTTTGATGGGAATAGCATTGG + Intergenic
1015200427 6:130573624-130573646 TACTGTGATGAGAAAGAAATAGG - Intergenic
1015211731 6:130706203-130706225 TAGTTTGATGGGAATAGCATTGG - Intergenic
1018354663 6:163000409-163000431 GAGTGTGATGGGAGTGCAATGGG - Intronic
1020492751 7:8809074-8809096 TATTGGGTGGGGAAAGGAATTGG - Intergenic
1021631534 7:22652168-22652190 TATTGTTATGGCAAAGGAAGAGG - Intergenic
1022042198 7:26591763-26591785 TGTTGTTGTGGGAATTGAATAGG - Intergenic
1022609630 7:31856610-31856632 TATTGTGATGAGGATGAAAATGG - Intronic
1024116716 7:46201183-46201205 GGTTGTCATGGGAATGGAACTGG - Intergenic
1024829173 7:53427758-53427780 TTCTGTGATGGAAATGGAAAAGG + Intergenic
1025794430 7:64725284-64725306 TATTTTGATGGGAATTGCATGGG + Intergenic
1026382040 7:69809531-69809553 GATTGGGGTGGGAAGGGAATTGG - Intronic
1027299084 7:76810553-76810575 GAGTGTGATGGGAATGGAAATGG + Intergenic
1027693305 7:81375207-81375229 TATTTTGATGGGAATTGCATTGG + Intergenic
1030841270 7:114357465-114357487 TATTATGAAGGGAATGGATACGG - Intronic
1031015488 7:116571285-116571307 TATTGTGATGAGAGAGGAGTGGG + Intergenic
1034700347 7:153089985-153090007 TATTTTGATTGGATTGGAATAGG + Intergenic
1040911334 8:52521953-52521975 CAGTGAGATGTGAATGGAATGGG - Intergenic
1041747192 8:61220708-61220730 TAGTTTGATGGGAATAGAATTGG + Intronic
1041810355 8:61902085-61902107 TATTGAGAAGGGCATGGAAGTGG + Intergenic
1041967267 8:63693871-63693893 TATTGTACTAGGAAAGGAATGGG + Intergenic
1043644702 8:82502227-82502249 TATTGAGAAGGGAATTGAAAGGG - Intergenic
1043981675 8:86649262-86649284 TATTTTGATGGGAATTGCATTGG - Intronic
1045836794 8:106531866-106531888 TATAGTGAGTGGGATGGAATGGG + Intronic
1046211266 8:111080457-111080479 TATCTTGAAGGGAATGGTATAGG - Intergenic
1047220637 8:122915771-122915793 TTTTGTGATGGCAATGGGAAAGG + Intronic
1050260785 9:3838729-3838751 AATTTTGATGGGAAAGGAAAAGG + Intronic
1052053558 9:23877469-23877491 TATTTTGAAGGGAATTGCATTGG + Intergenic
1052332269 9:27281966-27281988 TATTTTGAGGGGGATGGAAGGGG - Intergenic
1052674303 9:31599347-31599369 TATTGTGATAGGATTGGGGTAGG + Intergenic
1053066056 9:35070328-35070350 TATTTTGATGGGACAGGAGTGGG - Intronic
1055242434 9:74199715-74199737 TATTGTAAAAGGAATAGAATAGG - Intergenic
1055625315 9:78170939-78170961 CATTGTAATGTGAATGGAAGTGG - Intergenic
1056474011 9:86935460-86935482 GATTTTGATTGGAATTGAATGGG - Intergenic
1057964274 9:99488168-99488190 TAGTGTGCTGGGGATGGAAAGGG - Intergenic
1060695790 9:125707658-125707680 TATTGCTGTGGGAATCGAATGGG + Intergenic
1061337087 9:129946927-129946949 TATTGGGATGAGAAAGGAAAAGG - Intronic
1187368598 X:18685054-18685076 ATTGGTGATGGAAATGGAATGGG + Intronic
1189020343 X:37330691-37330713 TTTTATGAAGGGAATAGAATTGG - Intergenic
1189126096 X:38448393-38448415 TATTTTGATAGGAATTGCATTGG + Intronic
1189880601 X:45487458-45487480 TATAGTGATGGGACAGGCATGGG - Intergenic
1190126921 X:47714040-47714062 TAATTTGATGGGAATAGCATTGG - Intergenic
1191904918 X:66077293-66077315 TATTGGGAAGGGAAGGGAAGGGG - Intergenic
1193578876 X:83237005-83237027 TATTTTGATGGGAATTGTATCGG - Intergenic
1194314184 X:92354016-92354038 CATTGTGTTGGGTATGGAAGAGG + Intronic
1194518079 X:94883276-94883298 TATTTTGATAAGAATTGAATAGG + Intergenic
1194583746 X:95707920-95707942 TATTGTAATAGGAATGGTAATGG - Intergenic
1195227040 X:102807347-102807369 TTTTGTGATAGGAGTGGAATGGG - Intergenic
1196295674 X:113994129-113994151 TTTTGTGAGGGAAATGGGATAGG + Intergenic
1198781924 X:140247276-140247298 TATTGTTATGAGGATGCAATGGG + Intergenic
1198783854 X:140266250-140266272 TAGGGTAATGGGAATGGAAAAGG - Intergenic
1198995892 X:142573482-142573504 TATTTTGATGGGAATTGAACTGG - Intergenic
1199735981 X:150687123-150687145 GATTATCATGGGAGTGGAATTGG - Intergenic
1200300477 X:154969501-154969523 TATTGGCATGTGATTGGAATGGG - Exonic
1200622304 Y:5465858-5465880 CATTGTGTTGGGTATGGAAGAGG + Intronic
1200786327 Y:7263802-7263824 CATGGCGATGGGTATGGAATGGG - Intergenic
1201199988 Y:11530901-11530923 TACTATGAATGGAATGGAATCGG + Intergenic
1202041649 Y:20691556-20691578 TAGCTTGATGGGAATGGCATTGG + Intergenic