ID: 1070484003

View in Genome Browser
Species Human (GRCh38)
Location 10:76912457-76912479
Sequence GTATTTGTGGGGGATGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070483996_1070484003 24 Left 1070483996 10:76912410-76912432 CCTGGCATAATGCAGAACACATC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1070484003 10:76912457-76912479 GTATTTGTGGGGGATGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070484003 Original CRISPR GTATTTGTGGGGGATGTGGG AGG Intronic
No off target data available for this crispr