ID: 1070486245

View in Genome Browser
Species Human (GRCh38)
Location 10:76934580-76934602
Sequence AATGGGGTCTACAGGCAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070486245_1070486254 14 Left 1070486245 10:76934580-76934602 CCCTTTTGCCTGTAGACCCCATT 0: 1
1: 0
2: 2
3: 21
4: 176
Right 1070486254 10:76934617-76934639 ATAGACTATGGAGACAACAGGGG No data
1070486245_1070486251 2 Left 1070486245 10:76934580-76934602 CCCTTTTGCCTGTAGACCCCATT 0: 1
1: 0
2: 2
3: 21
4: 176
Right 1070486251 10:76934605-76934627 TTCTATGACAGCATAGACTATGG No data
1070486245_1070486252 12 Left 1070486245 10:76934580-76934602 CCCTTTTGCCTGTAGACCCCATT 0: 1
1: 0
2: 2
3: 21
4: 176
Right 1070486252 10:76934615-76934637 GCATAGACTATGGAGACAACAGG No data
1070486245_1070486253 13 Left 1070486245 10:76934580-76934602 CCCTTTTGCCTGTAGACCCCATT 0: 1
1: 0
2: 2
3: 21
4: 176
Right 1070486253 10:76934616-76934638 CATAGACTATGGAGACAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070486245 Original CRISPR AATGGGGTCTACAGGCAAAA GGG (reversed) Intronic
901950062 1:12737516-12737538 AAAGGGTTCTTCAGGAAAAAGGG + Intergenic
906483699 1:46218757-46218779 ACTGGTGTGTACAGGCAAGAAGG + Intronic
908851351 1:68379906-68379928 AATGAGGTCTTCAGGCAAAGAGG + Intergenic
911238980 1:95444186-95444208 AATGGGGTATATATACAAAATGG - Intergenic
912323748 1:108738602-108738624 AGTGGGGTTTACGGGCAAGAAGG - Intronic
916291015 1:163166178-163166200 AAGAGGGTCCACAGGGAAAAAGG + Intronic
916965690 1:169940087-169940109 AATGGGGTCTAGAGTAAAAATGG + Intronic
916981855 1:170146125-170146147 AGCGGGATCTAAAGGCAAAATGG - Exonic
921764105 1:218950448-218950470 AAGGGGGTCTTAAGGGAAAAAGG - Intergenic
924543773 1:245006242-245006264 AAAGGAGACTAAAGGCAAAAAGG + Intronic
924711757 1:246535260-246535282 ACTGGGGTCTCCAAGCACAATGG - Intergenic
1064484466 10:15771184-15771206 AGTTGGGACTACAGGCAACAGGG + Intergenic
1064825735 10:19397445-19397467 AATGGGGTCTATATACACAATGG - Intronic
1065308741 10:24394096-24394118 AATGGAGTCTATATGCAAAAAGG - Intronic
1065370942 10:24985682-24985704 TATGGGCTCCACAGACAAAATGG + Intronic
1066809683 10:39312337-39312359 ATTGAGGCCTACAGGAAAAAAGG - Intergenic
1066930039 10:41746851-41746873 ATTGAGGTCTACAGTGAAAAAGG + Intergenic
1066932191 10:41776764-41776786 ATTGAGGCCTACAGGGAAAAGGG + Intergenic
1069080756 10:64085892-64085914 AATGGGGCATTCAGGCATAAGGG + Intergenic
1069229259 10:65987820-65987842 AATGTGGTATACAAGCACAATGG + Intronic
1070486245 10:76934580-76934602 AATGGGGTCTACAGGCAAAAGGG - Intronic
1070642659 10:78180667-78180689 AATGGGGTCCCCAGGGAGAAGGG - Intergenic
1075816414 10:125267966-125267988 AATGTGGTCTAGATGCAGAATGG - Intergenic
1078620097 11:12899313-12899335 AATGGGGAGTACAGGGCAAAAGG - Intronic
1080726584 11:34904335-34904357 ATTGGGGTCTCCAAGCACAATGG - Intronic
1082597514 11:55102383-55102405 ATTGAGGTCTACAGTGAAAAGGG + Intergenic
1082841058 11:57690248-57690270 AATGAGGGCTAAAGGGAAAATGG + Intronic
1085221348 11:74876206-74876228 ACTGGGGTCTCCAAGCACAATGG - Intronic
1087423962 11:97966748-97966770 ACTGGGGTCTCCAGGCACAATGG + Intergenic
1088044145 11:105427169-105427191 AATGGGGTATATATGCACAATGG + Intergenic
1089168514 11:116496396-116496418 AATGTGGTCTACAAACACAATGG - Intergenic
1089560924 11:119342720-119342742 ACAGGGGTCTGCAGGCACAAGGG + Exonic
1094035645 12:26067657-26067679 AATGGGCTCCGCTGGCAAAACGG - Exonic
1094220927 12:27992609-27992631 AATGTGGTATACATACAAAATGG + Intergenic
1097443663 12:59642904-59642926 AATTGGGAATACAGGCACAAAGG + Intronic
1097605772 12:61751820-61751842 AATATGGTCAACAGGCCAAAAGG + Intronic
1098870527 12:75812383-75812405 ACTGGGGTCTACATACAAATGGG - Intergenic
1099602350 12:84757125-84757147 AATGGAGGCTACAGGGAGAAGGG - Intergenic
1100803395 12:98256639-98256661 AATGTGATATAAAGGCAAAAGGG - Intergenic
1101123904 12:101611332-101611354 CATGGGGGCTACAGACAAAATGG + Intronic
1101593936 12:106147155-106147177 AATGGGGCAAACAGGCAAATTGG - Intergenic
1101660673 12:106762711-106762733 AATTGTGTCTACAGCTAAAATGG + Intronic
1107511297 13:41088102-41088124 AACTGGGACTACAGGCAAACAGG + Intergenic
1110802082 13:79710042-79710064 AATGTGGTCAACAGGGAGAAGGG - Intergenic
1111486106 13:88902025-88902047 AATGTGGTATACATGCACAATGG - Intergenic
1111952375 13:94719385-94719407 AAAGGGATCTACATGGAAAAAGG - Intergenic
1112258280 13:97854625-97854647 AATGGTGGCTACAGGGAAAGAGG + Intergenic
1114539767 14:23446353-23446375 AGTGGGGTCTACAGCCCCAAAGG + Intergenic
1115115332 14:29874618-29874640 AATGTGGTCTACATACACAACGG + Intronic
1117163195 14:53008928-53008950 AATTGAGTCTACTGGCAAGATGG - Intergenic
1118127562 14:62925146-62925168 AATGTGGTCTACAGGCACCAGGG - Intronic
1120441137 14:84541581-84541603 AACTGGGACTGCAGGCAAAAAGG - Intergenic
1120922835 14:89770767-89770789 AATGGGCTCTAAAGACAAACTGG + Intergenic
1123845148 15:24292369-24292391 TATGGGGTCTCCATGCACAAGGG + Intergenic
1123863932 15:24497674-24497696 TATGGGGTCTCCATGCACAAGGG + Intergenic
1125305018 15:38302047-38302069 GATGGGATCCACAGGCAAAATGG - Intronic
1129887746 15:79050356-79050378 AATGTGGTCTACACACACAAGGG - Intronic
1133331735 16:4979059-4979081 AAGGGGATCTTCAGGCAAAGAGG + Intronic
1137462606 16:48679255-48679277 AAAGGGACCTAAAGGCAAAAAGG + Intergenic
1138329517 16:56202389-56202411 AATGTGGGCTACAGAAAAAAAGG + Intronic
1138696866 16:58822060-58822082 AATGTGGTATACATACAAAATGG - Intergenic
1138739050 16:59286390-59286412 AATGTGGTGTACAGACACAATGG + Intergenic
1142043854 16:87912794-87912816 AATGGCGGCTCCAGGCAGAAAGG + Intronic
1143434317 17:6912167-6912189 AATCTGGAATACAGGCAAAAAGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144062340 17:11594545-11594567 AGGGGGGTCTCCAAGCAAAAAGG - Intergenic
1144388045 17:14768375-14768397 AAAGGGCTCTACAGGGAAATTGG + Intergenic
1144441657 17:15287967-15287989 CATTGGTTCTACAGGCAAACAGG + Intergenic
1145016511 17:19402169-19402191 GATTGGCTTTACAGGCAAAAAGG + Intergenic
1145824793 17:27868703-27868725 CATGTGGTCTACAGGCCAAATGG + Intronic
1146397108 17:32477138-32477160 AATAGGGTCTAAGGGCAAGAAGG + Intronic
1148254874 17:46121534-46121556 AATAGGGTCATCAGGGAAAAAGG - Intronic
1152385449 17:79971552-79971574 AATGGTGTCTACCAGCAACATGG - Intronic
1153846481 18:9053960-9053982 AATGGAGGTTACAGGCAAGATGG + Intergenic
1156305881 18:35877692-35877714 ACTGGGGTCTCTAGGCACAATGG - Intergenic
1156895203 18:42238482-42238504 AATGTGATCTACATGCACAATGG - Intergenic
1157215724 18:45781877-45781899 ACTGGGGTCTCCATGCAGAATGG + Intergenic
1157521397 18:48347903-48347925 ACTGAGGTCAACATGCAAAAAGG + Intronic
1158123877 18:54081173-54081195 AATGTGATCTACAGACACAAGGG - Intergenic
1159112991 18:64082043-64082065 AATCTGGTCCCCAGGCAAAAAGG - Intergenic
1161727372 19:5937561-5937583 AATGGGGTCTTCAGACAAAAGGG + Intronic
1164327422 19:24209273-24209295 AATGAGGTCTACAGTCAAAAAGG - Intergenic
1165806594 19:38584463-38584485 AATGGGGGGTACAGGCAGAAGGG - Intronic
1165947338 19:39452092-39452114 AATGATGTTTACAGGCAGAAAGG + Intronic
1166184758 19:41132682-41132704 AAGGGGGTCAACATGCAGAAAGG + Intergenic
1168247128 19:55117880-55117902 AATGGAGTCTACAGGCCGGAGGG + Intergenic
926982471 2:18586098-18586120 AATGGGATTTACGGGCAGAAGGG + Intronic
928100652 2:28435647-28435669 TATGTGGTCTACAGTCAAAAGGG - Intergenic
929222216 2:39476553-39476575 AATGGGGGCTGAAGGAAAAACGG - Intergenic
929327698 2:40637209-40637231 AATGGGGTCACCATGGAAAAGGG - Intergenic
933368691 2:81388211-81388233 ACCGGGGTCTCCAGGCACAATGG - Intergenic
935377896 2:102419299-102419321 AATGGGGTCTAAAGCCACCATGG + Intronic
940545881 2:155084583-155084605 AATGTGGTCTATAGACAACATGG - Intergenic
940573858 2:155474731-155474753 AATGTGGTCTACAGACAACATGG - Intergenic
943420601 2:187663325-187663347 AGTGGGGTCTTAAGGGAAAATGG + Intergenic
943858129 2:192825265-192825287 AATGTGGTATACATGCACAATGG + Intergenic
944959483 2:204854930-204854952 AAAGGGGTCTCCAAGCAAAAAGG + Intronic
945647600 2:212518946-212518968 AATAGGGATCACAGGCAAAAAGG + Intronic
947959071 2:234219565-234219587 AATGTGGGCTACAGGCAGACTGG - Intergenic
948077898 2:235180785-235180807 AATGTGGTCTATAAACAAAAAGG + Intergenic
948734632 2:239993800-239993822 AAGGGGGTCAGCAGGGAAAAAGG + Intronic
949066408 2:241993394-241993416 AATGGGGTCTTCATGGAAAGGGG - Intergenic
1169072503 20:2741812-2741834 AATGTGGAATACAGGCAGAATGG + Intronic
1170579613 20:17687893-17687915 AAGGGGGTCTGCAGGCAGGAAGG + Intergenic
1170860982 20:20103316-20103338 AATAGGTTATACATGCAAAATGG - Intronic
1172750761 20:37249439-37249461 AGTGGGCCTTACAGGCAAAAAGG - Intergenic
1172924725 20:38522702-38522724 AATGGTATATACAGGCAAATAGG + Intronic
1175350282 20:58313183-58313205 ATTGGGAGCTACTGGCAAAAAGG - Intronic
1177514164 21:22125882-22125904 AATGGGCTTTGCAGGCAATATGG - Intergenic
1179374520 21:40837781-40837803 AATGGCCTCTACCAGCAAAACGG - Intronic
1181439071 22:22926596-22926618 AATGGGGGCCACAGGGAAATGGG - Intergenic
1181448396 22:22998507-22998529 AATCTGGTCTACAGACCAAATGG + Intergenic
1181729759 22:24836311-24836333 AATGTGGTCTACACACACAATGG - Intronic
949159711 3:866180-866202 AATGGGGACCACAGTGAAAATGG - Intergenic
949990897 3:9578265-9578287 ACTGTGGTCTACAGGCCATATGG + Intergenic
951802463 3:26611592-26611614 AATGGGCTCTACTGGAAGAATGG + Intergenic
953050225 3:39334915-39334937 AATGGCATTTACAGGCAGAAAGG - Intergenic
953425569 3:42794491-42794513 AATGGGTTGTACAGGGGAAACGG - Intronic
953672120 3:44972027-44972049 AAACAGATCTACAGGCAAAACGG + Intronic
955475631 3:59333318-59333340 AAAGGGGTTTATAGGGAAAAAGG + Intergenic
956543226 3:70367584-70367606 AATGTAGTATACATGCAAAATGG - Intergenic
956905938 3:73765276-73765298 AATGTGGTATACACGCACAATGG + Intergenic
957158404 3:76576493-76576515 TATGGGGTCTACTGACAAAATGG - Intronic
960335820 3:116416436-116416458 AATGGGTTATAGAAGCAAAATGG + Intronic
960758006 3:121039579-121039601 AAGAGGGTCTTCAGGCAAAAGGG - Intronic
964565957 3:158052791-158052813 ATTAGGGTCTTCAGGCAAAATGG - Intergenic
964721072 3:159767595-159767617 AATGGGGTATACAATGAAAAGGG + Intronic
965128703 3:164666534-164666556 AATGGTGCCTACTTGCAAAAAGG + Intergenic
966119836 3:176509291-176509313 ACTGGGGTCTCCAAGCACAATGG + Intergenic
969470942 4:7388987-7389009 AATGGGATCTCCAGGCCAAAAGG + Intronic
971469948 4:27012702-27012724 AATGGTGACTGCAGGCAATAGGG + Intronic
972583206 4:40413633-40413655 AATGGGGAGTACAGACAGAATGG - Intergenic
972583561 4:40416455-40416477 GATGGGGCCTAAAGACAAAATGG - Intergenic
973668996 4:53195065-53195087 AATGGGCTCTACAGTCAGAATGG + Intronic
973972691 4:56229289-56229311 AAAAGGGGCTCCAGGCAAAAAGG - Intronic
975430349 4:74282675-74282697 AATGCGTTCTAGAGACAAAATGG + Intronic
976004941 4:80418853-80418875 AATGTGGTATACATGCACAATGG - Intronic
976462754 4:85331490-85331512 TATGGGGTCTATACACAAAAAGG - Intergenic
976704844 4:88008755-88008777 AATGGAGTGTCCAGGCAAGAAGG - Intronic
980793099 4:137645245-137645267 AAAAGTGTCTACAGGCAAAATGG + Intergenic
982092618 4:151893523-151893545 ATTCAGTTCTACAGGCAAAAAGG - Intergenic
983412838 4:167420932-167420954 ATTGGGGTCTCCAAGCACAATGG - Intergenic
984845999 4:184108124-184108146 GATGGCGGCTACAGGCAGAAAGG + Intronic
988243986 5:28653582-28653604 AATGTGGTATACATACAAAATGG - Intergenic
989841974 5:46087049-46087071 AATGTGGCCTACAGAGAAAAAGG + Intergenic
989851908 5:46223862-46223884 AATGAGGCCTACAGTGAAAAAGG + Intergenic
993846268 5:92947619-92947641 AATGTGGTTTACATGCACAATGG - Intergenic
995416843 5:111922246-111922268 ACTGGGGTCTCCAGGCACAATGG + Intronic
996607297 5:125338535-125338557 AATGTGGTCTATATGCACAATGG - Intergenic
996623203 5:125535981-125536003 AAGGGGGTCTATTGGAAAAATGG - Intergenic
997259917 5:132457742-132457764 AATGGGGTGTAATGGCAACAAGG - Intronic
998775343 5:145594081-145594103 AATGGGGTATATAGGAAAGATGG + Intronic
999944837 5:156583653-156583675 AATGGAGTATGAAGGCAAAATGG + Intronic
1004778401 6:18875079-18875101 AATGTGGTATACATACAAAATGG - Intergenic
1007486413 6:42183950-42183972 AGTGGTGTCAACAGGAAAAATGG - Intergenic
1013135368 6:107277145-107277167 GATGAGGTCTACAGAAAAAAAGG - Intronic
1013903121 6:115181379-115181401 AATGGGGTCTAGAGACAATGGGG - Intergenic
1018652955 6:166006534-166006556 AATGGGGTTTGCAGGCAAATCGG + Intergenic
1020734948 7:11936532-11936554 AATGTGGTATACATGCACAATGG - Intergenic
1021188004 7:17587891-17587913 AATGTGGTATATAGGCAACATGG + Intergenic
1025574293 7:62616459-62616481 ATTGAGGTTTACAGGGAAAAAGG - Intergenic
1026343377 7:69453236-69453258 AGCTGGGACTACAGGCAAAACGG - Intergenic
1027693628 7:81380448-81380470 AATGATGACTACAGGTAAAAAGG + Intergenic
1028322308 7:89475569-89475591 TGTGTGGTCTACTGGCAAAAAGG - Intergenic
1032490081 7:132318014-132318036 ACTCGGGTCTTCAGGGAAAATGG - Intronic
1032548725 7:132764919-132764941 AATGAGGACTACAGGTGAAATGG + Intergenic
1032565106 7:132933769-132933791 AAAGGGGCCCACTGGCAAAAGGG + Intronic
1033285377 7:140036730-140036752 AATGTGAAATACAGGCAAAACGG + Intronic
1039473155 8:37826314-37826336 GATGGGGTCTGGCGGCAAAACGG + Intronic
1040840889 8:51783130-51783152 AATGTGGTCTCCAAGTAAAACGG - Intronic
1041563661 8:59249763-59249785 AATGGGGTATATATGCACAATGG - Intergenic
1041988694 8:63958008-63958030 AATGAGGTCTTCATGAAAAAAGG + Intergenic
1044889791 8:96822261-96822283 AATGTGGTATATAGGCACAATGG - Intronic
1046387129 8:113519756-113519778 AATGGAGGCTACAGGAAAAGTGG - Intergenic
1048114879 8:131510080-131510102 AAAGGGGTCTCCAAGCAGAAAGG + Intergenic
1048328595 8:133457025-133457047 AATGTGCTCTACAGGAAAAGTGG + Exonic
1049011240 8:139889077-139889099 AATGTGGTCTATCCGCAAAATGG + Intronic
1050353714 9:4763527-4763549 AATGTGGTGGACAGGAAAAAGGG + Intergenic
1050389447 9:5123509-5123531 AATGTGGTATACATACAAAATGG - Intronic
1052554383 9:29995326-29995348 AATGGGGTCTATATACACAATGG - Intergenic
1055872260 9:80896092-80896114 AATGTGGTATACATGCATAAGGG + Intergenic
1056123623 9:83513656-83513678 AATGGGATTTCCAGGCAAGAGGG + Intronic
1057448157 9:95133580-95133602 CATGAGGGCCACAGGCAAAAAGG + Intronic
1058677355 9:107411817-107411839 AATGGGGTCTCCAGGCCAGGTGG + Intergenic
1059109933 9:111547046-111547068 AATGTGGTATACAAGTAAAATGG - Intronic
1185928397 X:4172601-4172623 AATGGGATATACATGCACAATGG - Intergenic
1186139528 X:6556330-6556352 AAAGGGGTCTCCAAGCAGAAAGG - Intergenic
1186818620 X:13263379-13263401 AATGGGGACTAAAATCAAAAAGG - Intergenic
1187489172 X:19734871-19734893 AATGTGGTCTATACACAAAATGG - Intronic
1189093468 X:38112650-38112672 AATGGGGAGGACAGGCATAAAGG + Intronic
1191218519 X:57959670-57959692 AATGTGGTATACAGGCACAATGG + Intergenic
1191265818 X:58392175-58392197 ATTGAGGTCTACAGTGAAAAAGG + Intergenic
1191268757 X:58434023-58434045 ATTGGGGTCAACAGTGAAAAAGG - Intergenic
1191269394 X:58443822-58443844 ATTGAGGTCTACAGTGAAAAAGG - Intergenic
1193352694 X:80480965-80480987 ATTGGGGTCTCCAAGCACAATGG - Intergenic
1193560301 X:83009745-83009767 ACTGGGGTCTCCAAGCACAATGG + Intergenic
1194026261 X:88754984-88755006 AATGTGCTATACAAGCAAAAAGG - Intergenic
1194422078 X:93688006-93688028 AATGTGATATACAGGCATAATGG - Intronic
1197443096 X:126513978-126514000 CATGGGGTTTTCAGACAAAAGGG + Intergenic
1200105580 X:153710229-153710251 AGTGGGGTGCACAGGCCAAAGGG + Intronic