ID: 1070488119

View in Genome Browser
Species Human (GRCh38)
Location 10:76950567-76950589
Sequence CCATCCAGGCATGCAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070488119_1070488132 8 Left 1070488119 10:76950567-76950589 CCACCCACTGCATGCCTGGATGG 0: 1
1: 0
2: 1
3: 21
4: 252
Right 1070488132 10:76950598-76950620 GGCTTACAATGCTTTGGGGGAGG No data
1070488119_1070488128 2 Left 1070488119 10:76950567-76950589 CCACCCACTGCATGCCTGGATGG 0: 1
1: 0
2: 1
3: 21
4: 252
Right 1070488128 10:76950592-76950614 CCATGTGGCTTACAATGCTTTGG No data
1070488119_1070488129 3 Left 1070488119 10:76950567-76950589 CCACCCACTGCATGCCTGGATGG 0: 1
1: 0
2: 1
3: 21
4: 252
Right 1070488129 10:76950593-76950615 CATGTGGCTTACAATGCTTTGGG No data
1070488119_1070488130 4 Left 1070488119 10:76950567-76950589 CCACCCACTGCATGCCTGGATGG 0: 1
1: 0
2: 1
3: 21
4: 252
Right 1070488130 10:76950594-76950616 ATGTGGCTTACAATGCTTTGGGG No data
1070488119_1070488131 5 Left 1070488119 10:76950567-76950589 CCACCCACTGCATGCCTGGATGG 0: 1
1: 0
2: 1
3: 21
4: 252
Right 1070488131 10:76950595-76950617 TGTGGCTTACAATGCTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070488119 Original CRISPR CCATCCAGGCATGCAGTGGG TGG (reversed) Intronic
900563979 1:3323471-3323493 CCGTCCACGCCTGCTGTGGGAGG - Intronic
900706642 1:4084905-4084927 TCATCCAGCCATGCAGCGAGAGG - Intergenic
902193490 1:14780464-14780486 CCATCCAGGCAGTGAGTGGGAGG - Intronic
902251466 1:15156346-15156368 ACAGCCAGGCCTGCAGAGGGAGG - Intronic
903592929 1:24470964-24470986 CCCTCCAGGCCAGCAGAGGGAGG + Intronic
904910094 1:33928142-33928164 CCATCCTTGCCTGCAGTGGAGGG + Intronic
910410203 1:86934882-86934904 CCAGGCAGGAATGCAGTGGCAGG - Intronic
911165658 1:94722326-94722348 GCAACCAGGCAGGCTGTGGGTGG - Intergenic
915163840 1:153937473-153937495 CCAAACAGGTAAGCAGTGGGTGG - Exonic
918363257 1:183780516-183780538 CCATCCAAGCATTCAGTGCTGGG - Intronic
919536071 1:198789283-198789305 CCCTCCAGGCCTGCTGGGGGTGG + Intergenic
920197450 1:204238512-204238534 CCATCTAGCCATAAAGTGGGTGG + Intronic
920304325 1:205009003-205009025 CCATCCAGGCTTCCTGAGGGTGG - Intronic
920504195 1:206505281-206505303 CCTTCCTGGAGTGCAGTGGGTGG - Intergenic
921212957 1:212915667-212915689 CCTTCCATCCAGGCAGTGGGAGG - Intergenic
922155232 1:223035911-223035933 CCATTCAGCCATGTGGTGGGAGG + Intergenic
923685315 1:236149354-236149376 CCAGCCAGGCGTGCAGAGGCAGG + Intronic
1062971174 10:1650714-1650736 CTATCCGGGACTGCAGTGGGCGG - Intronic
1063299918 10:4842106-4842128 CTAACCATGCATGCAGTTGGTGG - Intronic
1066302611 10:34110149-34110171 CCAGTCAGACATGCAGTGTGTGG + Exonic
1067704799 10:48598749-48598771 CAATGCAGGAAGGCAGTGGGAGG - Intronic
1070488119 10:76950567-76950589 CCATCCAGGCATGCAGTGGGTGG - Intronic
1071566390 10:86673472-86673494 CCACCCAGGCAGGCAGGGAGAGG + Intronic
1072685119 10:97532037-97532059 CCATCCTGGCAGGCAGTTGGAGG + Intronic
1072737904 10:97891576-97891598 CCCTCCAGGCTGGCAGTGGGCGG - Intronic
1073319025 10:102602767-102602789 CCTTCCGGGAAGGCAGTGGGAGG - Intronic
1073460963 10:103665680-103665702 CAGGCCAGGCAGGCAGTGGGCGG + Intronic
1075981769 10:126746459-126746481 CCATCAAGGCAGACAGTAGGAGG + Intergenic
1076803161 10:132841890-132841912 GCCTCCAGGCTTGCAATGGGAGG + Intronic
1076852627 10:133100474-133100496 CCGTCCAGGCAAGCAGTGGCAGG - Intronic
1076877466 10:133223297-133223319 CCATCCAGGCATGCTGTTCCCGG + Intronic
1077397355 11:2331683-2331705 CTATGCAGGCCTTCAGTGGGTGG + Intergenic
1077498042 11:2896252-2896274 CCATCCGGGGAGGCAGGGGGAGG - Intronic
1077740878 11:4843624-4843646 GCCTCCAGGCCTGTAGTGGGAGG + Intronic
1078645260 11:13136186-13136208 AAATCCAGGCAAGAAGTGGGTGG - Intergenic
1078849528 11:15151297-15151319 CCATGCAGGGAGGCTGTGGGTGG - Intronic
1079114654 11:17633733-17633755 CCATCCTGGCATGTCTTGGGTGG - Exonic
1081021188 11:37949396-37949418 ATATGGAGGCATGCAGTGGGTGG + Intergenic
1081603208 11:44509878-44509900 CCAGCCTGGAATGCAGTGGCAGG + Intergenic
1081745020 11:45466954-45466976 CCTTGGAGGCGTGCAGTGGGTGG - Intergenic
1082877377 11:58001997-58002019 CCAGGCTGGCATGCAGTGGCCGG + Intergenic
1083308344 11:61772238-61772260 CCTTCCTGGAATGCAGAGGGAGG - Intronic
1084307840 11:68298455-68298477 CGATCCTGGCCTGCAGAGGGAGG + Intergenic
1084830545 11:71765471-71765493 CCTTCCAGGCAGGCTGTGTGGGG + Intergenic
1085596778 11:77818733-77818755 CCAGGCAGGAATGCAGTGGCAGG - Intronic
1085621328 11:78040050-78040072 CCATCCAGGCACACAGAGTGTGG + Intronic
1086503619 11:87479340-87479362 GCTTCCAGGCCTGCAATGGGAGG - Intergenic
1087132912 11:94684343-94684365 CCATCCAGTCATCCAATGGGAGG + Intergenic
1087496427 11:98895560-98895582 CCATCAAGGCACTCTGTGGGAGG + Intergenic
1087629548 11:100634551-100634573 CCATCCACTCTTGCATTGGGTGG - Intergenic
1087754406 11:102039716-102039738 CCATGCTGGCATGCAGTGGCAGG - Intergenic
1088038819 11:105351199-105351221 GCCTCCAGGCCTGCAATGGGAGG + Intergenic
1088831359 11:113539578-113539600 CAATCCAGGCAGGTAGTGTGGGG - Intergenic
1090881593 11:130837595-130837617 CCATGCTGGAATGCAGTGGCAGG + Intergenic
1091244390 11:134079474-134079496 CCTTCCAGAGATGCAGTGGGTGG - Intronic
1091801153 12:3325447-3325469 CCTTCCAGGCATGCTGTAGAGGG - Intergenic
1092322639 12:7494372-7494394 CAACCTAGGCATGCAGTGAGGGG - Intronic
1093682861 12:22023385-22023407 GCCTCCAGGCCTGCAATGGGAGG - Intergenic
1094491203 12:30961828-30961850 CCTTCCAGGCATGCTGAAGGGGG + Intronic
1096110586 12:49026960-49026982 CCATCCAGAAGGGCAGTGGGCGG - Exonic
1096548843 12:52359255-52359277 CCATCCTGGGACTCAGTGGGAGG + Intergenic
1099385562 12:82008839-82008861 CCTTCCAGGATTGAAGTGGGTGG - Intergenic
1101336685 12:103802918-103802940 CCATCCAGGCATTCAGAGGAGGG + Intronic
1101903796 12:108810770-108810792 CCACCCGGGCAGGCAGTCGGGGG - Intronic
1104760282 12:131293994-131294016 CCATCCAGGGCTGCAGGGGCTGG - Intergenic
1105015585 12:132784954-132784976 CCATCGAGGCAGCAAGTGGGCGG - Intronic
1111367497 13:87268742-87268764 CCAGCCTGGAGTGCAGTGGGCGG + Intergenic
1112895605 13:104296174-104296196 CCTTCAATGCATGCAGTGAGTGG + Intergenic
1113276312 13:108734695-108734717 CCATGCTGCCAAGCAGTGGGTGG - Intronic
1113431171 13:110251466-110251488 CCATGCAGGCGTGCAGTAGATGG - Intronic
1114706677 14:24734378-24734400 CCATCCTGTAATGCAGTTGGAGG + Intergenic
1116191640 14:41673804-41673826 CCATCCGGGAATGAGGTGGGGGG - Intronic
1117708306 14:58497016-58497038 CCAGGCAGGAATGCAGTGGCGGG + Intronic
1119639290 14:76302722-76302744 CCATCCTGGAGTGCAGTGGCGGG + Intergenic
1119808270 14:77497030-77497052 CCATATAGGCATGCAGGGTGTGG - Intronic
1122643709 14:103177552-103177574 CGACCCAGGGCTGCAGTGGGGGG + Intergenic
1122837273 14:104436440-104436462 AGACACAGGCATGCAGTGGGAGG - Intergenic
1122920588 14:104878329-104878351 CCATCGAGGCAGGCAGAGGAGGG - Intronic
1124337548 15:28868598-28868620 CCAGCGAGGCCTGCAGTTGGGGG + Intergenic
1125343359 15:38696026-38696048 CCAACCAGGCTTCCAGTGGCAGG - Intergenic
1125654001 15:41341010-41341032 CCACCCAGCCATGCAGTTGAGGG - Intronic
1125721735 15:41848394-41848416 CCAGACAGGAATGCAGGGGGAGG + Exonic
1126330709 15:47528019-47528041 CCATCCAGACATGGGGTGGGAGG + Intronic
1126850463 15:52793833-52793855 CCACCCAGGGATCCAGGGGGAGG + Intergenic
1127116978 15:55738734-55738756 GCATGCAGGCAGGCAGAGGGAGG + Intronic
1128213267 15:65916850-65916872 CCAGCCAGGGGTGCAGTGGCAGG + Exonic
1128213478 15:65917988-65918010 CCATCCAGGAAAGCACTGGCAGG + Exonic
1128239856 15:66094424-66094446 CCAGCCAGGCTCGCAGTGGCAGG + Exonic
1129740832 15:77988824-77988846 CCACCCCTGCACGCAGTGGGTGG + Intronic
1129844892 15:78763716-78763738 CCACCCCTGCACGCAGTGGGTGG - Exonic
1129930381 15:79405599-79405621 GCTTCCAGGCATTCAGTGGTCGG - Intronic
1130053761 15:80505343-80505365 CCATCCAGAAATGCAGTGAGGGG + Intronic
1132847545 16:2007374-2007396 CCTTACAGGCAGGCAGTGGGAGG - Intronic
1137565259 16:49528748-49528770 CCATCCAGGAAAACAGGGGGAGG + Intronic
1137848565 16:51715513-51715535 CCACACAGGGAAGCAGTGGGTGG - Intergenic
1138054736 16:53820833-53820855 CCATCCAGGTGTGGAGTTGGGGG + Intronic
1139659557 16:68411475-68411497 CCACCCATGCCTGCAGTGGGAGG - Intronic
1140297252 16:73721163-73721185 CCAGGCTGGCATGCAGTGGCGGG + Intergenic
1140837277 16:78806756-78806778 CCAACCAGGTTTGCAGTGAGAGG + Intronic
1140994183 16:80243537-80243559 CCATCCAGGAGTGACGTGGGGGG + Intergenic
1141317784 16:82978420-82978442 GCCTCCAGGCCTGCAATGGGAGG - Intronic
1142435653 16:90055248-90055270 ACATCCAGGCATGCAAGGGGTGG - Intergenic
1143092345 17:4456291-4456313 ACTTCCACGCAAGCAGTGGGGGG + Intronic
1143463883 17:7122858-7122880 CCAGGCTGGCATGCAGTGGCAGG + Intergenic
1144178999 17:12734460-12734482 CCAGGTAGGCATGCAGTAGGTGG - Intronic
1145108546 17:20141082-20141104 CCATCAAGGTCTGCAGTGGCAGG - Intronic
1145279913 17:21459590-21459612 CCATCCAGGCATGGAGAGCTAGG - Intergenic
1146791038 17:35750653-35750675 CCATCCAGGCAAGCTGAGTGGGG - Intronic
1147152871 17:38528386-38528408 CCTTCCAGGCGTGCAGCGGATGG + Intergenic
1148725797 17:49789048-49789070 CGATCCAGGCAAGCAGAGGGCGG - Intronic
1149597992 17:57875287-57875309 CCACCCAGGAAAGCAGTGGAGGG + Intronic
1151282640 17:73088248-73088270 CCAGCCTGGCGTGCAGTGGCAGG - Intronic
1151899352 17:77001678-77001700 CCAGCCTGGAATGCAGTGGCAGG - Intergenic
1152667187 17:81577931-81577953 CCATCCTGGGCTGCAGTGTGGGG - Intronic
1158570021 18:58590380-58590402 TCAGCCAGGAATGCAGGGGGAGG + Intronic
1159957057 18:74526127-74526149 CCCTCCAGGGCTGCAGTGGGAGG + Intergenic
1160608053 18:80066969-80066991 CCCTCCAGGCAGGCAGAGGAGGG + Intronic
1160686285 19:438478-438500 CGCTCCTGGCATGGAGTGGGTGG - Intronic
1160867058 19:1260659-1260681 CCAACCAGGGGTGCAGCGGGCGG + Intronic
1161047777 19:2145481-2145503 ATATCTAGGCATGGAGTGGGTGG + Intronic
1161555011 19:4936185-4936207 GCTTCCAGGGATGCAGTGAGAGG + Intronic
1161564969 19:4996922-4996944 TGCTCCTGGCATGCAGTGGGTGG - Intronic
1161587524 19:5113691-5113713 CACTCCTGGCATGGAGTGGGTGG - Intronic
1161717064 19:5882198-5882220 ACTCCCAGGCTTGCAGTGGGCGG + Intronic
1161805543 19:6441226-6441248 CAATGCAGGAATCCAGTGGGTGG + Exonic
1161915629 19:7225858-7225880 CGCTCCAGGCATGGAATGGGTGG + Intronic
1163163175 19:15477652-15477674 CCAGGCTGGAATGCAGTGGGGGG - Intronic
1163218373 19:15897200-15897222 CAATGCAGGCCTGGAGTGGGAGG + Intronic
1163371872 19:16905667-16905689 GGATCCAGGGATGGAGTGGGAGG - Intronic
1163862426 19:19749285-19749307 CCGTCCAGGCATGGAGTGGACGG + Intergenic
1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG + Intergenic
1164991864 19:32690660-32690682 CCATGCCGGAATGCAGTGGCAGG + Intergenic
1165354659 19:35296062-35296084 CCATCCAGGCCTGCTGGGGAAGG - Intronic
926135265 2:10331652-10331674 ACAGCCGGGCGTGCAGTGGGGGG - Intronic
926354840 2:12032147-12032169 CCCTCCTGGCAGGCAGTGAGGGG + Intergenic
926956760 2:18310216-18310238 CCAGCCATGGATGCTGTGGGAGG - Intronic
928172101 2:29010509-29010531 GCATCCAGGCAGGCACTGAGGGG + Intronic
928409070 2:31040384-31040406 TCATCCAGCCTTGAAGTGGGAGG + Intronic
928976885 2:37096921-37096943 CCATCCAAGCATGAAGAGGAGGG + Exonic
931450820 2:62366378-62366400 CAGGCCAGGCATGCAGGGGGAGG - Intergenic
932006545 2:67933321-67933343 GCCTCCAGGCCTGCAATGGGAGG - Intergenic
932344818 2:70988574-70988596 CCATGCAGGCAGGATGTGGGGGG - Exonic
933967231 2:87440039-87440061 CCTTCTGAGCATGCAGTGGGAGG + Intergenic
936326564 2:111510456-111510478 CCTTCTGAGCATGCAGTGGGAGG - Intergenic
939016847 2:136913513-136913535 GCCTCCAGGCCTGCAATGGGAGG - Intronic
940293307 2:152098578-152098600 CAGTCGAGGCTTGCAGTGGGTGG - Intronic
941745612 2:169083547-169083569 CCATCCAAATATGCAGTGGAAGG + Exonic
942998148 2:182290556-182290578 CCCTTCAGGCAAGCAGAGGGAGG - Intronic
943331489 2:186564811-186564833 CCATGCTGGAATGCAGTGAGTGG - Intergenic
948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG + Intergenic
1169352513 20:4880724-4880746 GCACCCAGGCATGCAGAGGTGGG - Intronic
1169964007 20:11195267-11195289 CCATGCAGGAATGCAGGGCGAGG + Intergenic
1170594471 20:17794679-17794701 CTATCCTGGCATCCAGTTGGGGG - Intergenic
1171255780 20:23688236-23688258 CCATCCTGGCCTGCAGGGGTGGG + Intronic
1171334993 20:24376269-24376291 CCATCCAGACATGAACTGGGAGG + Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172367111 20:34358595-34358617 CCAGGCAGGAATGCAGTGGCAGG + Intergenic
1174174341 20:48635582-48635604 CCAGCCAGGCAGACAGTGTGAGG - Intronic
1174427065 20:50439315-50439337 CTGCCCAGGCCTGCAGTGGGCGG + Intergenic
1175268022 20:57714283-57714305 CCGTCCAGGCAGGCCGGGGGTGG - Intergenic
1176373146 21:6074532-6074554 CCTGCCAGGCCGGCAGTGGGTGG - Intergenic
1177045171 21:16160149-16160171 CCAGCCAGGGATGTGGTGGGCGG + Intergenic
1177411495 21:20735469-20735491 GAATTCAGTCATGCAGTGGGAGG + Intergenic
1179750331 21:43463711-43463733 CCTGCCAGGCCGGCAGTGGGTGG + Intergenic
1180200899 21:46223487-46223509 CCATCCAGACATGCCCTGTGTGG + Intronic
1180848012 22:18995005-18995027 CTATCCAGCCAGGAAGTGGGTGG + Intergenic
1181805709 22:25373462-25373484 CTCTCCTGGCATCCAGTGGGTGG - Intronic
1182096559 22:27630056-27630078 CCAGCCAGGAATGAACTGGGAGG + Intergenic
1183407802 22:37639164-37639186 CCAGCCAGTCATCCAGTGGTGGG + Intronic
1183467310 22:37986275-37986297 CCAGGCAGGCAGGCAGCGGGCGG - Intronic
1183749098 22:39709208-39709230 CCATCCAAGCAGCCAGCGGGTGG + Intergenic
1184252567 22:43269105-43269127 CCTTCCAGGCAAGCAGACGGAGG + Intronic
1185197727 22:49482884-49482906 GAATCCAGGCATCCAGAGGGGGG - Intronic
952058321 3:29475920-29475942 CCTTCCTGGCATGCAGAGAGTGG + Intronic
953884576 3:46708034-46708056 GCATCCAGGCATACACTTGGAGG - Intronic
954676707 3:52319888-52319910 CCATGCAAGCTGGCAGTGGGGGG - Intronic
955489102 3:59464698-59464720 CCATCTAGGCATGGAGAGAGGGG + Intergenic
956845830 3:73181831-73181853 CCATCCAAGCATGAAGAGGAGGG - Intergenic
960050398 3:113233811-113233833 CCTTCCAAGCATGGGGTGGGTGG - Intronic
961333469 3:126156499-126156521 CTGTCCAGGCATGCAGCAGGAGG - Intronic
961486565 3:127221403-127221425 CCAGCCAGGGCTGCAGTTGGTGG - Intergenic
961825636 3:129597712-129597734 CCAGACAGGCATCCAGTGGCAGG - Intronic
961889604 3:130119740-130119762 CCTTCCAGGCAGGCTGTGTGGGG - Intergenic
962201117 3:133401859-133401881 GCATCCTGGGATGAAGTGGGAGG - Intronic
962794851 3:138841200-138841222 TCACCCAGGCGTGCAGTGGCAGG - Intergenic
963569242 3:146971035-146971057 CCAGGCTGGAATGCAGTGGGTGG - Intergenic
968594009 4:1473148-1473170 ACAGCCTGGCCTGCAGTGGGTGG + Intergenic
968660626 4:1797374-1797396 CCTAGCAGGCAGGCAGTGGGGGG + Intronic
968706617 4:2081273-2081295 CCTGCCAGGCATGCATGGGGAGG + Intronic
968972104 4:3801394-3801416 CCATCCAGGGACCCAATGGGAGG - Intergenic
969443698 4:7232461-7232483 CCATCCTGGGCTGCCGTGGGGGG - Intronic
972766579 4:42156977-42156999 CCATGGAGGCATGCAGGTGGAGG + Intergenic
973681178 4:53321931-53321953 CCATGCAGGCAGGGTGTGGGAGG - Intronic
976581384 4:86740550-86740572 ACCTCCAGGCCTGCAATGGGAGG + Intronic
976729279 4:88245502-88245524 CAAGCCAGGCATGAAGTGGCAGG - Intergenic
979641507 4:123016041-123016063 CCATCCGGGAAGGAAGTGGGGGG - Intronic
980379341 4:131991265-131991287 CCATCCAGGCCAGGAGTTGGGGG + Intergenic
980387931 4:132111063-132111085 CCATCTAGCCATAAAGTGGGTGG - Intergenic
980577835 4:134708369-134708391 CCATGCAGGTATGCTGTGAGAGG - Intergenic
982850554 4:160309768-160309790 CCAGCCAGGAGTGCAGTGGCGGG - Intergenic
984727491 4:183035749-183035771 CCATCATGGCATGTAGAGGGGGG + Intergenic
985959185 5:3286833-3286855 CATCCCAGGCATGCAGTTGGAGG - Intergenic
986193075 5:5514740-5514762 CAATCAAGCAATGCAGTGGGTGG - Intergenic
986772806 5:10988940-10988962 CCAGCCAGACAGGCAGTGAGTGG - Intronic
990660360 5:58007238-58007260 CCAGGCTGGCATGCAGTGGTGGG - Intergenic
991985710 5:72284378-72284400 CCAGGCTGGCATGCAGTGGCAGG - Intronic
993756451 5:91735890-91735912 CCAGCCAGGCAGGCAGTTAGGGG - Intergenic
994619935 5:102150940-102150962 CCATCCAGAAAGGCAGGGGGAGG - Intergenic
997022091 5:130013725-130013747 GCCTCCAGGCCTGCAATGGGAGG + Intronic
997257990 5:132443973-132443995 CAAGCCAGGGATGCAGAGGGAGG - Intronic
998522870 5:142816684-142816706 CCTTGCAGGGAAGCAGTGGGTGG + Intronic
999181073 5:149670492-149670514 CCATCCAGGAAGGATGTGGGGGG - Intergenic
999277333 5:150339918-150339940 CCAGGCAGGAATGCAGTGGCAGG - Intergenic
1000908213 5:166989189-166989211 CCATCCACCCATCCACTGGGAGG - Intergenic
1001088781 5:168721595-168721617 CCATGCAGGAATGCAGGGGTAGG + Intronic
1003757329 6:9136471-9136493 CCAGCCAGGCCTGCAGTGACAGG + Intergenic
1003958902 6:11191171-11191193 TCATCCCGGCAAGCAGAGGGCGG + Exonic
1004721395 6:18270545-18270567 CCCTCAAGGCAAGCAGTTGGAGG + Intergenic
1006644560 6:35507038-35507060 CAACCCTGGTATGCAGTGGGAGG - Intronic
1010020651 6:71156104-71156126 CCACCCAGGCCTGCTGTGGGTGG + Intergenic
1012730478 6:102874437-102874459 CCATCTAGCCATGAAATGGGTGG + Intergenic
1013106624 6:107031340-107031362 CCAGGCTGGAATGCAGTGGGTGG - Intronic
1013911212 6:115278464-115278486 CCAGCCAGGCCCCCAGTGGGTGG - Intergenic
1014726539 6:124978388-124978410 TCAACCAGGCATGCTGTGAGCGG + Intronic
1017259949 6:152374426-152374448 CCATGGAGGCATGCTGTGGTGGG + Intronic
1017547592 6:155468518-155468540 GCCTCCAGGCATGTGGTGGGAGG + Intergenic
1017895787 6:158678670-158678692 CCATCTAGGCATCCAGTGCTTGG + Intronic
1018721530 6:166576880-166576902 GCCTCCAGGCCTGCAATGGGAGG - Intronic
1019904168 7:4048271-4048293 CCATCAAGGCTTCCACTGGGTGG - Intronic
1020291323 7:6724633-6724655 CCAGCCTGGAATGCAGTGGTGGG - Intergenic
1021988828 7:26123042-26123064 CCATCTAGCCATAAAGTGGGTGG + Intergenic
1025212116 7:57025780-57025802 CCTCCAAGGCATGCAGTGGACGG + Intergenic
1025659838 7:63551048-63551070 CCTCCAAGGCATGCAGTGGACGG - Intergenic
1028995241 7:97092857-97092879 CTATGCAGGAATGAAGTGGGAGG + Intergenic
1029675294 7:102064535-102064557 CCTCCAAGGCATGCAGTGGATGG + Intronic
1032407387 7:131666546-131666568 TCATCCAGGCTTGAGGTGGGAGG - Intergenic
1033129346 7:138732440-138732462 CCATCTTGGCATCCAGTGGAGGG - Intronic
1034738881 7:153454982-153455004 CCATCCAGGCATTTCCTGGGAGG - Intergenic
1035129537 7:156639934-156639956 CTTTCCAGGCTTGCAGCGGGCGG - Exonic
1036711427 8:11081921-11081943 CCAGCCCGACAGGCAGTGGGTGG + Intronic
1036902330 8:12679609-12679631 CCCTCCAGCCCTGCAGTGTGAGG - Intergenic
1037294388 8:17385342-17385364 CAATCCCCGCATGCCGTGGGAGG + Intronic
1037355191 8:18011585-18011607 CCATGCAGGAATGCAGTAAGTGG + Intronic
1039118916 8:34124029-34124051 CCACCCATGCATGCATTTGGTGG + Intergenic
1039777291 8:40749603-40749625 CCCTCAAAGCCTGCAGTGGGTGG - Intronic
1040436603 8:47397666-47397688 CCAGCCTGGCATGCACTGAGGGG + Intronic
1040581331 8:48700999-48701021 CCACCCAGGAAAGCAATGGGTGG - Intergenic
1046788206 8:118291282-118291304 CCATCCAGGCCTGCAGGAGAGGG + Intronic
1047996431 8:130341184-130341206 CCATCCAGGCAAGCTGTGGGTGG - Intronic
1048985419 8:139732315-139732337 CCAGCCTGGCAGGGAGTGGGTGG - Intronic
1049298030 8:141854138-141854160 GCATCCAGGCACCCAGGGGGCGG + Intergenic
1049393879 8:142388599-142388621 CCAAGCTGGAATGCAGTGGGAGG + Intronic
1050000607 9:1073333-1073355 ACATCCAGGCTTCCAGTGAGAGG - Intergenic
1051819363 9:21146579-21146601 CCATGCTGGAATGCAGTGGGAGG - Intergenic
1052056462 9:23913072-23913094 CCAGGCAGGAATGCAGTGGCTGG - Intergenic
1053192839 9:36087894-36087916 CCATCGAGGCCTGTAGAGGGAGG - Exonic
1054917743 9:70511229-70511251 CCATCCATGCCTGCAGTCAGAGG + Intergenic
1056530107 9:87479400-87479422 CCAGGCTGGCATGCAGTGGCAGG + Intergenic
1056860306 9:90175054-90175076 CCAGGCTGGCATGCAGTGGCAGG - Intergenic
1060881867 9:127123058-127123080 CCAACGAGGCATCCAGGGGGAGG - Intronic
1061863109 9:133478102-133478124 CCATCCAGGCCACTAGTGGGTGG - Intronic
1062186014 9:135218924-135218946 TCTTCCAGGCAGGCAGTGCGTGG + Intergenic
1062203421 9:135321324-135321346 TCATTCAGGCCAGCAGTGGGAGG + Intergenic
1062400401 9:136370209-136370231 CCTTCCAGGCACGGAGTGGGCGG + Intronic
1189436535 X:40997870-40997892 CAATCCAGTCATGGGGTGGGTGG + Intergenic
1189893856 X:45633215-45633237 ACATGCAGGCATGCAGGGGCTGG - Intergenic
1190410989 X:50136969-50136991 GCATGCAAGCATGCAATGGGAGG - Intergenic
1191036587 X:56031376-56031398 CGATACAGGCATGCTGTGGGTGG + Intergenic
1191256108 X:58280296-58280318 ACATCCAGGCTTTCAGGGGGAGG - Intergenic
1192342722 X:70277499-70277521 CCATCCAGGCCTGGAGTTGTAGG - Exonic
1193046566 X:77060620-77060642 CCACCCAGGCTTGGAGAGGGTGG + Intergenic
1193707831 X:84844623-84844645 CCATCAAGGCAGCCAGAGGGAGG - Intergenic
1197249928 X:124205046-124205068 CCAGGCTGGCATGCAGTGGTGGG + Intronic
1199874684 X:151920714-151920736 CAATCCAGGCAAGCCCTGGGTGG + Intronic
1201295183 Y:12456114-12456136 ACATCTAGGCACGCGGTGGGCGG - Intergenic