ID: 1070495876

View in Genome Browser
Species Human (GRCh38)
Location 10:77021750-77021772
Sequence TCATCCCCATGTGAGGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070495866_1070495876 15 Left 1070495866 10:77021712-77021734 CCTCTTATTCCCTGTGAACAGGG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1070495876 10:77021750-77021772 TCATCCCCATGTGAGGTGTAAGG No data
1070495874_1070495876 5 Left 1070495874 10:77021722-77021744 CCTGTGAACAGGGGTGAGGGGGT 0: 1
1: 0
2: 2
3: 22
4: 188
Right 1070495876 10:77021750-77021772 TCATCCCCATGTGAGGTGTAAGG No data
1070495863_1070495876 24 Left 1070495863 10:77021703-77021725 CCAGGATGCCCTCTTATTCCCTG 0: 1
1: 0
2: 1
3: 27
4: 189
Right 1070495876 10:77021750-77021772 TCATCCCCATGTGAGGTGTAAGG No data
1070495864_1070495876 16 Left 1070495864 10:77021711-77021733 CCCTCTTATTCCCTGTGAACAGG 0: 1
1: 0
2: 0
3: 19
4: 229
Right 1070495876 10:77021750-77021772 TCATCCCCATGTGAGGTGTAAGG No data
1070495872_1070495876 6 Left 1070495872 10:77021721-77021743 CCCTGTGAACAGGGGTGAGGGGG 0: 1
1: 0
2: 0
3: 24
4: 261
Right 1070495876 10:77021750-77021772 TCATCCCCATGTGAGGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070495876 Original CRISPR TCATCCCCATGTGAGGTGTA AGG Intronic
No off target data available for this crispr