ID: 1070496778

View in Genome Browser
Species Human (GRCh38)
Location 10:77031675-77031697
Sequence AGAGATGCAGCCTCTGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070496773_1070496778 18 Left 1070496773 10:77031634-77031656 CCAATGTCACAATCCTGGGCTTA 0: 1
1: 0
2: 1
3: 17
4: 313
Right 1070496778 10:77031675-77031697 AGAGATGCAGCCTCTGTTGGAGG No data
1070496775_1070496778 5 Left 1070496775 10:77031647-77031669 CCTGGGCTTAAGGACTGCATCCT 0: 1
1: 0
2: 0
3: 17
4: 284
Right 1070496778 10:77031675-77031697 AGAGATGCAGCCTCTGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070496778 Original CRISPR AGAGATGCAGCCTCTGTTGG AGG Intronic
No off target data available for this crispr