ID: 1070499900

View in Genome Browser
Species Human (GRCh38)
Location 10:77062930-77062952
Sequence TCTGGTTGCATGGCTGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070499900_1070499910 20 Left 1070499900 10:77062930-77062952 CCCCAACCAGCCATGCAACCAGA 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1070499910 10:77062973-77062995 CTCCCAAAGAGCTATGGTGATGG No data
1070499900_1070499914 29 Left 1070499900 10:77062930-77062952 CCCCAACCAGCCATGCAACCAGA 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data
1070499900_1070499907 14 Left 1070499900 10:77062930-77062952 CCCCAACCAGCCATGCAACCAGA 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data
1070499900_1070499911 21 Left 1070499900 10:77062930-77062952 CCCCAACCAGCCATGCAACCAGA 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1070499911 10:77062974-77062996 TCCCAAAGAGCTATGGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070499900 Original CRISPR TCTGGTTGCATGGCTGGTTG GGG (reversed) Intronic
901295264 1:8156354-8156376 TCTGGTTGGATGACTGGGTTAGG + Intergenic
903785815 1:25860542-25860564 TCTGGCTGCAGAGATGGTTGAGG - Intergenic
904035539 1:27556870-27556892 TCTAGTTGGATGGCTGTTGGTGG - Intronic
904667326 1:32133051-32133073 AGTGGTTGCAGGGCTGGGTGCGG + Intronic
905656637 1:39690194-39690216 TCTGGTTCTATGGCTGATTATGG - Intronic
908379514 1:63582893-63582915 TCCTTTTGCATGGCTGGGTGCGG - Intronic
911470717 1:98314819-98314841 TGTGGTTCCATGGCAGGTTGTGG + Intergenic
912225143 1:107724807-107724829 TCTGGTTGCAACACTGGATGTGG + Intronic
912231340 1:107796151-107796173 GCTGGTTGCATGGCATTTTGAGG - Intronic
914457872 1:147853647-147853669 CCTGGGTGCCTGGCTGGTTTAGG - Intergenic
919088436 1:192949350-192949372 TCTGGTTTCAAGGCTGAGTGTGG + Intergenic
922228794 1:223667966-223667988 TCTGGTTTTAGGGGTGGTTGGGG - Intergenic
923851623 1:237802533-237802555 TCTGGGCCCATGGCTGGATGAGG - Intronic
1066695728 10:38076136-38076158 TCTGGTTGCATAACTGTGTGGGG - Intergenic
1067155329 10:43776594-43776616 ACAGGTAGCATGGCTGGGTGGGG - Intergenic
1067160145 10:43818922-43818944 TCTGGGTCCCTGGCTGCTTGGGG + Intergenic
1069773685 10:70914813-70914835 TCTGGTTGCCTGGCTGGTCTAGG - Intergenic
1070499900 10:77062930-77062952 TCTGGTTGCATGGCTGGTTGGGG - Intronic
1071525631 10:86356461-86356483 TGTGGCCACATGGCTGGTTGTGG + Intronic
1071939509 10:90573377-90573399 TCTGGCTGCTTGGCTGGCTTGGG + Intergenic
1076016194 10:127029270-127029292 TCTGCATGCAGGGCTGGCTGGGG - Intronic
1077464240 11:2726055-2726077 TCTGTATGCATGGCTGCCTGGGG - Intronic
1079299249 11:19262884-19262906 GCTATTTGCATGGTTGGTTGGGG + Intergenic
1080349848 11:31370736-31370758 TCTGGTTCCATGGATGATGGCGG + Exonic
1081745050 11:45467217-45467239 AGAGGTTGCATAGCTGGTTGTGG + Intergenic
1083654990 11:64225267-64225289 TCTGGCTGCTTGGCTGGAGGGGG + Intronic
1084580117 11:70017982-70018004 TCTGATGGGATGGATGGTTGGGG - Intergenic
1084713529 11:70859188-70859210 TCTGGATGGATGGGTGGATGAGG + Intronic
1086476042 11:87175788-87175810 TCTGGTTGTATAGCTAGATGTGG + Intronic
1087681563 11:101224294-101224316 TGTGGTTGCTTGGTTGGTTTGGG + Intergenic
1088922216 11:114268436-114268458 CTTGGTTGCATGGCTGGTTTGGG - Intronic
1089396498 11:118139339-118139361 TCTGGCTGAATGGGTGTTTGTGG - Intronic
1091785923 12:3243427-3243449 TCTGGTTTCACGGCAGTTTGTGG + Intronic
1092731429 12:11538657-11538679 TCTGTTTCCCTGGCTTGTTGAGG + Intergenic
1096685603 12:53286438-53286460 TCTCGTTTGATGGCTGGTTCAGG - Exonic
1101300838 12:103478758-103478780 TTTGGTTGGCTGGTTGGTTGGGG + Intronic
1103358452 12:120339413-120339435 TCTGTTTGAAGGGCTGGGTGCGG + Intergenic
1103534430 12:121625125-121625147 TCTGTTTGCATGGCGGGCTCTGG + Intergenic
1103598417 12:122038503-122038525 TATGATTGTATGGCTGGTTGGGG - Intronic
1104618321 12:130289727-130289749 TCTGAATGCCTGGCTGGCTGTGG - Intergenic
1105431646 13:20342583-20342605 TCAGCTGGCATGGCTGGTGGAGG + Intergenic
1105476332 13:20730824-20730846 CCTGGTTGCACTGCTGGCTGCGG - Intronic
1106388666 13:29313949-29313971 ACTGGTTGCTTGGCTGAGTGTGG - Intronic
1107087256 13:36438712-36438734 TCTGGTGGACTGGCTGGTGGAGG + Exonic
1113487697 13:110666371-110666393 GCTGGCTGCGTGGCTGTTTGAGG - Intronic
1113903056 13:113807055-113807077 TCTGGCTCCAGGGCTGGTTTGGG + Intronic
1113922852 13:113923825-113923847 TTTGGTTGTATGGCTGGCTTTGG - Intergenic
1115791711 14:36886958-36886980 TCTCGTTGCATTGTTGATTGTGG - Intronic
1116428277 14:44816668-44816690 TCTAGGTGCATGGCTGGATTAGG - Intergenic
1117411079 14:55451737-55451759 TCTGGTTGCATGCCTAGGTTTGG + Intronic
1119286785 14:73461652-73461674 TCCTGTTGCATGGCTGGCTGTGG + Intronic
1121494506 14:94382838-94382860 GCTGGCTGTCTGGCTGGTTGAGG + Exonic
1122364602 14:101187156-101187178 TTTGGTGGTAGGGCTGGTTGGGG + Intergenic
1123500285 15:20875929-20875951 TGTGTTTGCATGGGTGGGTGTGG - Intergenic
1123557531 15:21449622-21449644 TGTGTTTGCATGGGTGGGTGTGG - Intergenic
1123593758 15:21886903-21886925 TGTGTTTGCATGGGTGGGTGTGG - Intergenic
1123694114 15:22864509-22864531 TCCAGTTTCATGGCTGGCTGTGG + Intronic
1130046768 15:80451762-80451784 TTTGGTTGGTTGGATGGTTGGGG - Intronic
1131097161 15:89663393-89663415 TCAGGGTCCATGGCTGGTTCAGG + Intergenic
1131886123 15:96915071-96915093 TATAGTTGAATGGCTGGGTGCGG + Intergenic
1202965881 15_KI270727v1_random:176794-176816 TGTGTTTGCATGGGTGGGTGTGG - Intergenic
1133846106 16:9455135-9455157 GCTGGTTGCTTGGTTGGTTGGGG + Intergenic
1134245794 16:12539008-12539030 TCTGGATTCATGGATGGTTTTGG - Intronic
1136366993 16:29813508-29813530 TCTGGTTGAAGGGCTGGCTTGGG - Exonic
1137572522 16:49576099-49576121 TCTGGTTCCATGTCTGGGTATGG - Intronic
1138277495 16:55746596-55746618 CCGGGCTGCATAGCTGGTTGAGG - Intergenic
1139388202 16:66588057-66588079 TCTGGTGGCTTGGCGGGTTCTGG - Exonic
1142228158 16:88887430-88887452 TCTGGATCCCTGGCTGGCTGGGG + Intronic
1144186521 17:12801438-12801460 GCTGGTTGCATAGCTGGTGAGGG + Intronic
1144738135 17:17566324-17566346 CCTGGTTGCATGGCTTCCTGGGG + Intronic
1145052648 17:19675484-19675506 TTGTGTTGCAAGGCTGGTTGTGG + Intronic
1146352561 17:32107391-32107413 ACTGGTTGCACTGTTGGTTGAGG + Intergenic
1151566735 17:74902645-74902667 TCTGGGTGACTGGCTTGTTGGGG - Intergenic
1154168767 18:12035791-12035813 TCTTGTTGCTTGGAGGGTTGGGG + Intergenic
1155203580 18:23538042-23538064 ACTGGCTGCCTGGCTGGATGGGG + Intronic
1157174424 18:45438253-45438275 TCTCTCTGCATGACTGGTTGAGG + Intronic
1157604564 18:48917751-48917773 TCTGGCAGCATGGCTGATTCCGG - Intergenic
1158347728 18:56532603-56532625 CGGGGTTGCATGGCTAGTTGTGG + Intergenic
1161470659 19:4455473-4455495 GCAGGGTCCATGGCTGGTTGGGG - Intronic
1161783446 19:6308869-6308891 TCTGCTTGCATGTCTGTTTCTGG + Intronic
1162719470 19:12653694-12653716 TCAGGTTGAATGGCTGGGTGTGG - Intronic
1162827568 19:13263046-13263068 TCTGGTCCCAGGGTTGGTTGAGG + Intronic
926069248 2:9872035-9872057 TCTGGATGTCTGGCTGGGTGTGG + Intronic
928288707 2:30018131-30018153 TCTGCCTGCAGGGCTGCTTGGGG - Intergenic
928551767 2:32378745-32378767 ACTGGTTGTGTGGCTGGGTGCGG - Intronic
935578622 2:104736353-104736375 TAGGGTTGTAGGGCTGGTTGGGG + Intergenic
946160034 2:217830423-217830445 TCTGGTTTTAGGGCTGGGTGGGG - Intronic
946280884 2:218664664-218664686 TCTGGGGCCATGGCTGATTGGGG + Intronic
948613936 2:239186153-239186175 TCCGGTTTCCTGGCTGTTTGTGG - Intronic
1168971156 20:1931722-1931744 TCAGGTTGCAGGGCTGGTGGAGG + Intronic
1169060964 20:2660086-2660108 TCTGGCTGCTGGCCTGGTTGGGG - Exonic
1169482615 20:5998409-5998431 TCTGGTGGCATGTGTGGTTGAGG + Intergenic
1172196571 20:33095900-33095922 TCTGGTCCCATGTCTGGTTCTGG + Intronic
1172634522 20:36401069-36401091 TCTGGTTGCTGGGCGGGTGGGGG - Intronic
1179602481 21:42489396-42489418 GCTGTTTGATTGGCTGGTTGTGG + Intronic
1183616076 22:38946503-38946525 TCGGGTTTTATGGCTGGTTTGGG + Intergenic
1184124832 22:42479726-42479748 TTAGGTTGTATGGCTGGTTTGGG - Intergenic
1184133035 22:42529151-42529173 TTAGGTTGTATGGCTGGTTTGGG - Intergenic
950442773 3:13019558-13019580 CCTGGCTGGCTGGCTGGTTGGGG + Intronic
951948147 3:28166040-28166062 TTTGCTTCTATGGCTGGTTGAGG - Intergenic
953369201 3:42372914-42372936 TTAGGATGCATGGCTGGGTGTGG + Intergenic
953863501 3:46564695-46564717 TCTCTCTGCATGGCTGGTTAAGG - Intronic
954362895 3:50131738-50131760 TCTGGCTGCCTGGCTGTTTGGGG + Intergenic
954678332 3:52327615-52327637 TCAGGTGGCTTGGCTGGATGGGG + Intronic
955791921 3:62597061-62597083 TCTCTTTGCATGGCTGGGTGTGG + Intronic
956495301 3:69819405-69819427 TGTGGTTGCATGTCTGGTTCTGG + Intronic
957661173 3:83155633-83155655 TCTGTTGGCTTGGCTGGTTCAGG - Intergenic
961533732 3:127556570-127556592 TATGCTTGTAAGGCTGGTTGCGG - Intergenic
965544175 3:169898670-169898692 TCTGGTTGGTTGGTTGTTTGGGG - Intergenic
969889747 4:10249059-10249081 GCTGCTTGCATGGCTGGTCCAGG - Intergenic
969897366 4:10317943-10317965 TCTGGGTGCAGTGCTGATTGCGG + Intergenic
972745176 4:41925127-41925149 TCTCTGTGCATGGCTGGATGGGG + Intergenic
976095627 4:81505771-81505793 TTTGGTTGCTTGGTTGGTTTTGG - Intronic
982012668 4:151121806-151121828 TCTGGTGGCATGGCAGCATGGGG - Exonic
984767149 4:183408340-183408362 CCTGGATGCATGGCTGTCTGGGG - Intergenic
985295222 4:188430665-188430687 TCTGGGAGCATGGCTGGGAGTGG - Intergenic
985711804 5:1433585-1433607 TGTGGATGGATGGATGGTTGTGG - Intronic
985711841 5:1433773-1433795 TGTGGATGGATGGATGGTTGTGG - Intronic
985852657 5:2399966-2399988 TCTGCTTGCAGGCCTGCTTGTGG - Intergenic
986878444 5:12139827-12139849 TCCTGCTGCTTGGCTGGTTGTGG - Intergenic
990366240 5:55073455-55073477 TTTGGTTTCATGGCTGGGTGCGG + Intergenic
990847932 5:60165190-60165212 TGTTGTTGCATGGATGATTGAGG + Intronic
992145256 5:73840526-73840548 TCTGGATTCAGGGCTGGTAGTGG - Exonic
994771307 5:103985400-103985422 TCTGGTTGCAGGGGTGGAGGGGG + Intergenic
996477357 5:123936810-123936832 TCTGGTTCCATGGCTGGGGGGGG - Intergenic
997390942 5:133515071-133515093 TTTGGTTGCATGGCTTATCGGGG - Intronic
998126969 5:139630831-139630853 TCTGCTTTCTTGGCTGGGTGTGG - Intergenic
999923395 5:156347460-156347482 TCTGGTTGGATGTAGGGTTGAGG + Intronic
1000616452 5:163433099-163433121 TCAGGTTCTATGGCTGGTAGAGG - Intergenic
1005286251 6:24330238-24330260 ACTGTTTGGATGGCTTGTTGTGG + Intronic
1005572450 6:27158363-27158385 TCTGCTTGGCTGACTGGTTGGGG - Intergenic
1006078715 6:31551521-31551543 TCTGGTGGCAGGGCTGGCAGAGG - Intronic
1006386441 6:33733659-33733681 TGGTGTTGCCTGGCTGGTTGTGG - Intronic
1007321542 6:41031921-41031943 TCTGTGTGCATGGCTGCATGGGG + Intronic
1010471548 6:76234099-76234121 GCTGGGTGCATGGCTGCATGAGG - Intergenic
1011039956 6:83018986-83019008 TTTTGATGCATGGCTGGTAGAGG + Exonic
1018399291 6:163405987-163406009 TCTGGGTGCCTGGCTGTTGGTGG - Intergenic
1019822416 7:3255094-3255116 TCTGGTTTTATGGCTGGCTTGGG + Intergenic
1022769480 7:33453979-33454001 TCTGACTGCATGGCGGGGTGTGG + Intronic
1024598763 7:50961730-50961752 TCTGGTTCCCTGGCTGGAGGAGG + Intergenic
1024628985 7:51231886-51231908 GCTGCTTCCATGGCTGGGTGGGG - Intronic
1025783170 7:64619825-64619847 TCTGGTTTCATGGCTTGGAGAGG + Intergenic
1027367461 7:77473214-77473236 ACTGGTATCATGGCTGGATGTGG - Intergenic
1029060473 7:97792388-97792410 GCTGGTTGGTTGGTTGGTTGAGG + Intergenic
1029926738 7:104327333-104327355 TCTGGTTTCATGGCTGGGGGTGG + Intergenic
1034052155 7:147995167-147995189 TTTGGGTGCATGCCTGGTAGGGG - Intronic
1035040266 7:155921799-155921821 TCTGGTTGTTTTGCTGGCTGGGG + Intergenic
1035177628 7:157063237-157063259 TCTAGTTGAATGCCTGATTGTGG + Intergenic
1038671872 8:29589415-29589437 TCGGGATGCAGGGCTGGTTGTGG - Intergenic
1044003987 8:86919359-86919381 ACTGCTCACATGGCTGGTTGGGG - Intronic
1048173251 8:132128908-132128930 TCTGTTTGGTTGGCTGGTTTGGG - Exonic
1048196221 8:132334008-132334030 ACTTGTTTCATGGCTGGGTGTGG - Intronic
1048512041 8:135071853-135071875 TGAGGTTACATGGATGGTTGAGG - Intergenic
1049052818 8:140212138-140212160 TCTGCTTACCTGGCTGGATGAGG - Intronic
1049180465 8:141219531-141219553 TCAGGCTGCATGGAGGGTTGAGG - Intronic
1049191263 8:141289067-141289089 GCTGGTTTCATGGCCGGCTGAGG - Intronic
1051541963 9:18229985-18230007 TTTGGTTAAATGGCTGGGTGCGG - Intergenic
1052028995 9:23607193-23607215 TTTGGTTTCATGGCTTGCTGTGG - Intergenic
1053497457 9:38558906-38558928 TCTGGTTGTATGACAGGATGTGG - Intronic
1055937733 9:81618959-81618981 TCTGGTTGGATAGATGGTTAGGG - Intronic
1056514418 9:87336472-87336494 TCTGGCTGCATGTCAGGTAGGGG - Intergenic
1057379360 9:94554421-94554443 TGGGGTTGCATTGCTGGTGGTGG - Intergenic
1057512691 9:95693772-95693794 TCTGGTTATATGGCAGCTTGGGG + Intergenic
1058585457 9:106502022-106502044 TGTGATTGCATGGCTGACTGGGG - Intergenic
1061533989 9:131236282-131236304 TCTGGTTACAGAGCTGGTGGGGG - Intergenic
1062006023 9:134238925-134238947 TCTGGTCTCTTGGCTGGGTGAGG + Intergenic
1062358776 9:136177738-136177760 TAGGGTTGCAGTGCTGGTTGGGG + Intergenic
1185652576 X:1659117-1659139 TATGGTTGTGTGGCTGGTAGAGG + Intergenic
1185700390 X:2227101-2227123 TGTGGGTGCAGGGCTGGCTGGGG - Intronic
1185722859 X:2395849-2395871 TCTAGTTGCATTGCTGATAGAGG - Intronic
1189232912 X:39466092-39466114 TGTGGTGGCAGGGGTGGTTGGGG - Intergenic
1190077799 X:47331033-47331055 TCTGGTGGCTAGGCTGGGTGTGG - Intergenic
1190373761 X:49767971-49767993 TCTGATTGAAAGGCAGGTTGGGG + Intergenic
1192503515 X:71667825-71667847 TCCGTTTGCAGGGCTGGTTTAGG + Intergenic
1195160265 X:102163874-102163896 ACTTGTTGCATTGCTGGGTGAGG - Intergenic
1196421571 X:115527614-115527636 TTTGGTTGCATACCTGGGTGTGG + Intergenic
1197325201 X:125084233-125084255 GATGGATGGATGGCTGGTTGAGG - Intergenic
1198128301 X:133669213-133669235 TCTAGTGGCATGGATGGTGGTGG - Intronic
1198751986 X:139945274-139945296 TCTGGTTGCCTGGGCGATTGTGG - Intronic
1200095709 X:153659749-153659771 GCTGGGTGCATAGCTGGGTGCGG + Intergenic
1200755573 Y:6987031-6987053 TATGGTTGCATGGGTACTTGAGG + Intronic
1200936903 Y:8746244-8746266 GCTGGCTGCATTTCTGGTTGTGG - Intergenic