ID: 1070499901

View in Genome Browser
Species Human (GRCh38)
Location 10:77062931-77062953
Sequence TTCTGGTTGCATGGCTGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070499901_1070499910 19 Left 1070499901 10:77062931-77062953 CCCAACCAGCCATGCAACCAGAA 0: 1
1: 0
2: 1
3: 24
4: 167
Right 1070499910 10:77062973-77062995 CTCCCAAAGAGCTATGGTGATGG No data
1070499901_1070499907 13 Left 1070499901 10:77062931-77062953 CCCAACCAGCCATGCAACCAGAA 0: 1
1: 0
2: 1
3: 24
4: 167
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data
1070499901_1070499911 20 Left 1070499901 10:77062931-77062953 CCCAACCAGCCATGCAACCAGAA 0: 1
1: 0
2: 1
3: 24
4: 167
Right 1070499911 10:77062974-77062996 TCCCAAAGAGCTATGGTGATGGG No data
1070499901_1070499914 28 Left 1070499901 10:77062931-77062953 CCCAACCAGCCATGCAACCAGAA 0: 1
1: 0
2: 1
3: 24
4: 167
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070499901 Original CRISPR TTCTGGTTGCATGGCTGGTT GGG (reversed) Intronic
900890727 1:5447912-5447934 TTCTGGTTGCAGAGCTGGCCTGG - Intergenic
901097842 1:6696682-6696704 TTCTAGTTTCATGGCTGTTCTGG + Intronic
904079157 1:27861240-27861262 TTCTGGTGGCCAGGCTGGTTAGG - Intergenic
905158141 1:36005907-36005929 TTTTGGTTGGATGGAGGGTTTGG + Intronic
908489902 1:64633077-64633099 TTATGATTGCATGGCTGACTGGG + Intronic
908816101 1:68035924-68035946 TACAGGATGCATGGCTGGTGTGG - Intergenic
913030430 1:114897294-114897316 CTCTGGTTGCATGACCGTTTTGG + Intronic
917151918 1:171955196-171955218 TACTGCTTGCATGGCTGCATTGG + Intronic
917305062 1:173616309-173616331 TTCTGGGGGCAGGGCAGGTTGGG - Intronic
918124104 1:181567486-181567508 TTCTGATTGGTTGGTTGGTTTGG - Intronic
918535280 1:185567143-185567165 TTCTCATTGCATGGTTTGTTTGG - Intergenic
918739597 1:188111370-188111392 TTGTGGTTGCATGGCTGACTAGG + Intergenic
919550770 1:198983616-198983638 TTCTGGTTGTGTGTCAGGTTAGG - Intergenic
919980106 1:202637684-202637706 TCCTGGCTGCAGGGCTGGCTGGG + Intronic
922228795 1:223667967-223667989 TTCTGGTTTTAGGGGTGGTTGGG - Intergenic
922477149 1:225914421-225914443 TTCTGCTTGAATGTCAGGTTGGG - Intronic
923035326 1:230281282-230281304 ATCTGGTTGCATGGCAGGGGAGG - Exonic
1065971608 10:30810250-30810272 CTCTAGTGGCATGGCTGGTAGGG + Intergenic
1067160144 10:43818921-43818943 TTCTGGGTCCCTGGCTGCTTGGG + Intergenic
1068941535 10:62685523-62685545 TTCTGGATGCATGTCTATTTGGG - Intergenic
1069717629 10:70531158-70531180 TTCAGGTTGCAGGGATGGTGTGG + Intronic
1069870611 10:71530514-71530536 TTCTTGTTGCCTGGCTGGCATGG + Intronic
1070499901 10:77062931-77062953 TTCTGGTTGCATGGCTGGTTGGG - Intronic
1071759010 10:88579382-88579404 TTTAGGTTTTATGGCTGGTTTGG + Intronic
1071939508 10:90573376-90573398 CTCTGGCTGCTTGGCTGGCTTGG + Intergenic
1072009637 10:91291859-91291881 CTCTGGTTGCCTGGATGGCTGGG - Intergenic
1073870281 10:107855224-107855246 TGCAAGTTGAATGGCTGGTTTGG - Intergenic
1075299399 10:121308026-121308048 TTGTGGTTGCATCTCTTGTTGGG + Intergenic
1076613149 10:131738809-131738831 TGCTGGTTACATGGATGATTTGG - Intergenic
1078713145 11:13814464-13814486 TCATGGTTGCATGGCTGCCTGGG - Intergenic
1078723877 11:13910149-13910171 TTCTGCTGGCTTGCCTGGTTAGG - Intergenic
1078941894 11:16015615-16015637 TCCTGGCTCCATGGCTGGCTAGG - Intronic
1079299248 11:19262883-19262905 TGCTATTTGCATGGTTGGTTGGG + Intergenic
1083600331 11:63943357-63943379 TTCTCATTGCCTGGCTGGTTTGG - Intronic
1084580118 11:70017983-70018005 TTCTGATGGGATGGATGGTTGGG - Intergenic
1086782140 11:90920800-90920822 TCCTGATTGCATGGCTGACTGGG - Intergenic
1086823839 11:91470645-91470667 TTCTCTTAGCATGGCTCGTTTGG + Intergenic
1087234246 11:95700609-95700631 TTCTGCTTTCAAGTCTGGTTTGG - Intergenic
1087681562 11:101224293-101224315 ATGTGGTTGCTTGGTTGGTTTGG + Intergenic
1088922217 11:114268437-114268459 GCTTGGTTGCATGGCTGGTTTGG - Intronic
1088988529 11:114930265-114930287 TTCTGGGTCCCTGGCTTGTTGGG + Intergenic
1089639941 11:119841273-119841295 TACTGCTTGTATTGCTGGTTAGG + Intergenic
1091133617 11:133167831-133167853 TTCTGGTTGGGTGACTGGGTGGG - Intronic
1091144202 11:133263010-133263032 TTCTGCTTGCATTATTGGTTTGG - Intronic
1093852238 12:24054645-24054667 TTCTGGTTGCCAGGATGGCTGGG - Intergenic
1098740989 12:74172841-74172863 TTCTGCTTATATGGCTGGATTGG - Intergenic
1100725283 12:97401840-97401862 TGCTGGTCTCATGGCTGTTTTGG - Intergenic
1102210660 12:111124584-111124606 TTTAGGTTTTATGGCTGGTTTGG + Intronic
1102674800 12:114650127-114650149 TTCTTGTTGAATGGCAGGATCGG - Intergenic
1102690010 12:114753191-114753213 TACTGGCTTCATGGCTGGTGTGG - Intergenic
1103598418 12:122038504-122038526 CTATGATTGTATGGCTGGTTGGG - Intronic
1103619652 12:122179070-122179092 TGCTTGTTGGTTGGCTGGTTTGG + Intronic
1103806595 12:123578547-123578569 TTCTGGCTGCATCTTTGGTTTGG + Intergenic
1108505438 13:51108466-51108488 TTCAGGCTTCATGGCTGGTGGGG - Intergenic
1108894133 13:55301762-55301784 TTCTGGATCCATGGCTTCTTAGG - Intergenic
1113795289 13:113053649-113053671 TTCTGCCTGAATGGGTGGTTCGG + Intronic
1113903055 13:113807054-113807076 CTCTGGCTCCAGGGCTGGTTTGG + Intronic
1114541850 14:23466561-23466583 TTTAGGTTTTATGGCTGGTTTGG - Intergenic
1116834665 14:49758436-49758458 TCATGATTGCATGGCTGATTGGG + Intergenic
1122956149 14:105072390-105072412 TGCTGGTTGCACGGGTGTTTAGG + Intergenic
1123418073 15:20106378-20106400 TTCTGGCTGGCTGGCTGGCTTGG + Intergenic
1123694304 15:22866056-22866078 TTGTGGTTGCATTTCTGCTTGGG + Intronic
1124495720 15:30185729-30185751 TCCTGGCTGCAGGGCTGGCTGGG + Intergenic
1124747853 15:32352917-32352939 TCCTGGCTGCAGGGCTGGCTGGG - Intergenic
1125455298 15:39852634-39852656 TACTTGTGGCATAGCTGGTTAGG - Intronic
1128197407 15:65772389-65772411 TTCTGCTTTCATGATTGGTTCGG - Intronic
1130046769 15:80451763-80451785 TTTTGGTTGGTTGGATGGTTGGG - Intronic
1131843586 15:96465251-96465273 TACTGGTTGCATTACTGCTTAGG + Intergenic
1133846105 16:9455134-9455156 GGCTGGTTGCTTGGTTGGTTGGG + Intergenic
1135912360 16:26572743-26572765 TTCAGGATGCATGGATGTTTGGG - Intergenic
1136366994 16:29813509-29813531 CTCTGGTTGAAGGGCTGGCTTGG - Exonic
1139156466 16:64448955-64448977 TTCTGGTTCCATGGCTGCAAAGG - Intergenic
1140678169 16:77354620-77354642 TCTTGGTTGCATGGTTGATTAGG - Intronic
1141471349 16:84240608-84240630 TGCTGGTTGGATGGTTGGGTGGG + Intergenic
1144138203 17:12319628-12319650 TTTTGGTTGGTTGGTTGGTTGGG - Intergenic
1144186520 17:12801437-12801459 TGCTGGTTGCATAGCTGGTGAGG + Intronic
1144839488 17:18176996-18177018 TGTTGGTTGCATGGGTGGGTGGG + Intronic
1145887280 17:28391225-28391247 GTTTGGTTGATTGGCTGGTTGGG + Intronic
1146841050 17:36154523-36154545 CTCTGGTTGCTTGGCTGGCTGGG + Intergenic
1146853296 17:36242169-36242191 CTCTGGTTGCTTGGCTGGCTGGG + Intronic
1146869204 17:36366059-36366081 CTCTGGTTGCTTGGCTGGCTGGG + Intronic
1147072078 17:37966690-37966712 CTCTGGTTGCTTGGCTGGCTGGG + Intergenic
1147083604 17:38046222-38046244 CTCTGGTTGCTTGGCTGGCTGGG + Intronic
1147099550 17:38170189-38170211 CTCTGGTTGCTTGGCTGGCTGGG + Intergenic
1149858485 17:60106446-60106468 CTCTGGTTGGCTGGCTGGCTGGG - Intergenic
1150082561 17:62253483-62253505 CTCTGGTTGCTTGGCTGGCTGGG + Intergenic
1150224794 17:63518421-63518443 TTCTGGTTTCAGGGAGGGTTTGG - Intronic
1152557726 17:81062770-81062792 TGCTGGTGGCTTAGCTGGTTTGG + Intronic
1153942040 18:9986785-9986807 TTCTCGCTGCAGGGCTGGTCAGG + Intergenic
1154377824 18:13823686-13823708 ACTTGGTTGCTTGGCTGGTTGGG - Intergenic
1157589770 18:48829343-48829365 TTCTGAGTGCAGGTCTGGTTGGG + Intronic
1158221333 18:55153942-55153964 TTCTGGTTTGAGGTCTGGTTGGG + Intergenic
1158483253 18:57841399-57841421 TTTTGTTTGGTTGGCTGGTTTGG - Intergenic
1159497925 18:69230029-69230051 TTCTGGTTGCAGAGCTGGAAAGG + Intergenic
1159880993 18:73858375-73858397 GTCTTGTTGCATGGTTGGTGTGG - Intergenic
1161977333 19:7613676-7613698 GGCTGGTTGCATGGGTGGGTGGG + Intronic
1168059323 19:53882485-53882507 TTCTGGGGCCATGGCTGGTCTGG + Exonic
928285620 2:29987809-29987831 TTCTGTTTGCATCTCTGCTTTGG + Intergenic
929140895 2:38665889-38665911 TCCTGGTTGCATTGCATGTTGGG - Exonic
929549390 2:42879908-42879930 TTATGGTTGCAAAGCTGGTGAGG + Intergenic
930152752 2:48075287-48075309 CTCTGGCTGCAAGGCTGGCTTGG + Intergenic
932409459 2:71536680-71536702 TGGTGGTTGCATCTCTGGTTTGG + Intronic
932748423 2:74354718-74354740 TACTGGGTGCATGGCCTGTTAGG - Intronic
933317550 2:80733900-80733922 TTTTGGTGGCCTGGCTGGTGGGG - Intergenic
940287485 2:152047059-152047081 TGCTGGCTGCATGGCTAGCTAGG - Intronic
942920091 2:181362782-181362804 TCCAGTTTGCTTGGCTGGTTAGG - Intergenic
946142639 2:217704690-217704712 TTCTGTTTGGTTGGGTGGTTTGG - Intronic
947771844 2:232676369-232676391 TCCTGGCTGCATGGGAGGTTAGG + Intronic
948423397 2:237874113-237874135 GTCTGGCTGCAGGGCTGGTCCGG - Intronic
1169459997 20:5786211-5786233 TTTAGGTTCTATGGCTGGTTTGG - Intronic
1172976114 20:38907285-38907307 GTCTGGTTGAATGGATGGGTGGG + Intronic
1175386098 20:58596264-58596286 GTCTAGCTGCAAGGCTGGTTGGG - Intergenic
1182291123 22:29280648-29280670 TTCTGGTTGGTTGGATGGTTTGG + Intronic
1183616075 22:38946502-38946524 TTCGGGTTTTATGGCTGGTTTGG + Intergenic
1183975916 22:41512182-41512204 TGCTGGTTACCTGGGTGGTTAGG - Intronic
1184124833 22:42479727-42479749 TTTAGGTTGTATGGCTGGTTTGG - Intergenic
1184133036 22:42529152-42529174 TTTAGGTTGTATGGCTGGTTTGG - Intergenic
950442771 3:13019557-13019579 TCCTGGCTGGCTGGCTGGTTGGG + Intronic
952210669 3:31226343-31226365 TCCTGGTTTCCTGGCTGGATCGG - Intergenic
954362894 3:50131737-50131759 TTCTGGCTGCCTGGCTGTTTGGG + Intergenic
956339157 3:68202034-68202056 TTCTGCTTTCATGGCTGACTTGG - Intronic
956580727 3:70809342-70809364 ATCTGGTTGCAAGGTAGGTTGGG + Intergenic
957581202 3:82075782-82075804 TTCTGGTTGCATCACTGATCAGG - Intergenic
958498718 3:94878012-94878034 TTATAGTGGCATGGCAGGTTAGG - Intergenic
958884080 3:99706608-99706630 TTCTGACTCCTTGGCTGGTTAGG + Intronic
960050080 3:113231110-113231132 TTATGGTTGAAGGGGTGGTTGGG + Intronic
963173968 3:142279710-142279732 CTCTGGTTCCATGGCTGGGGGGG + Intergenic
965544176 3:169898671-169898693 TTCTGGTTGGTTGGTTGTTTGGG - Intergenic
968088697 3:195886357-195886379 TTCTGGCTTCAGGGCTGGGTTGG - Intronic
970583996 4:17497737-17497759 TTCTGGGTGCTTGGCTTGTTGGG - Intronic
972745175 4:41925126-41925148 TTCTCTGTGCATGGCTGGATGGG + Intergenic
974666505 4:64969274-64969296 ATCTGCTTTCATGGCTGGTGTGG + Intergenic
976926657 4:90506014-90506036 TTCTATTTGCATGTCTGTTTAGG + Intronic
978190968 4:105911628-105911650 TTCTTCTTGCATGGCTGCTTTGG - Intronic
979808682 4:125007786-125007808 TCATGATTGCATGGCTGATTGGG - Intergenic
983906876 4:173192543-173192565 TTCTGGTGGCATGGCAGCTTGGG - Intronic
983939381 4:173524607-173524629 TGCTGGGTGTCTGGCTGGTTAGG + Intergenic
984519572 4:180785726-180785748 CTCTGGTTGGTTGGTTGGTTTGG - Intergenic
986577301 5:9225789-9225811 TTCTCATTCAATGGCTGGTTGGG - Intronic
987516545 5:18917789-18917811 TTCAGGTTGCTTGCCTGGTAGGG - Intergenic
990413362 5:55562854-55562876 TCCTGGTCGCATGGCTGACTGGG - Intergenic
992547896 5:77833048-77833070 TTGTGACTGCATAGCTGGTTGGG - Intronic
992940360 5:81754663-81754685 TTCTGGTGACATTGCTGGTCAGG - Intergenic
993793889 5:92242352-92242374 TCCTGATTGCATGGCTGACTGGG - Intergenic
996045062 5:118862684-118862706 TTCTGGTGGCAAGGAAGGTTGGG - Intronic
996477358 5:123936811-123936833 CTCTGGTTCCATGGCTGGGGGGG - Intergenic
998588789 5:143455544-143455566 TTCTGATTGCGTGGCTGACTGGG + Intergenic
999177027 5:149638925-149638947 CTCTGGTTGCCTGGTAGGTTTGG + Intergenic
999279179 5:150353781-150353803 TTCTGCTTGGGTGGCTGGATGGG - Intergenic
1003096292 6:3145626-3145648 TTCGGGTTGGAGTGCTGGTTCGG + Intronic
1003096377 6:3146050-3146072 TTCGGGTTGGAGTGCTGGTTCGG + Intronic
1003096388 6:3146104-3146126 TTCCGGTTGGAGTGCTGGTTCGG + Intronic
1003096397 6:3146140-3146162 TTCGGGTTGGAGTGCTGGTTCGG + Intronic
1003096418 6:3146230-3146252 TTCTGGTTGGAGTGCTGATTCGG + Intronic
1003096433 6:3146301-3146323 TTCGGGTTGGAGTGCTGGTTCGG + Intronic
1003749980 6:9044097-9044119 TTCTACTTTCATGGCTTGTTTGG + Intergenic
1009555444 6:65158931-65158953 TGTTGGTTGCATGCTTGGTTGGG - Intronic
1009615001 6:65992454-65992476 TACAGGTTGCATGGCTGGGGAGG + Intergenic
1009680232 6:66882116-66882138 TACAGGTAGCATGGCTGGTGTGG + Intergenic
1009896928 6:69763397-69763419 TTCTGCTGGGATGGCTGATTAGG - Intronic
1011780209 6:90780225-90780247 TGCTGCTAGGATGGCTGGTTTGG - Intergenic
1017166054 6:151409394-151409416 TTCTGGTTGAATGACTAGATAGG + Intronic
1019213475 6:170424466-170424488 GTGTGGTTGCATGGCTGCTGTGG + Intergenic
1019822415 7:3255093-3255115 TTCTGGTTTTATGGCTGGCTTGG + Intergenic
1022565699 7:31398764-31398786 ATCTGGTTGTCTGGTTGGTTTGG - Intergenic
1023709661 7:42977991-42978013 TTCAGGTAGCATGGCTGGAGAGG - Intergenic
1024628986 7:51231887-51231909 TGCTGCTTCCATGGCTGGGTGGG - Intronic
1024874094 7:54001055-54001077 TTCTGTTTGCATGGCTGTTCTGG + Intergenic
1030364235 7:108627498-108627520 TTCTGGATCCATCGCTGGATTGG + Intergenic
1032191545 7:129768791-129768813 TTCTGGTTGGATGGCTCTTGTGG - Intergenic
1032511329 7:132475023-132475045 TTCTGGCTGCACTTCTGGTTTGG - Intronic
1034052156 7:147995168-147995190 TTTTGGGTGCATGCCTGGTAGGG - Intronic
1034161426 7:148996694-148996716 CTCTGGTGGCAGGGCTGGTTAGG - Intergenic
1034344398 7:150377493-150377515 TGCTGGTTGCAGGGCTAGCTAGG + Intronic
1037876352 8:22550832-22550854 TGTTGGTTGGTTGGCTGGTTTGG + Intronic
1041958221 8:63580779-63580801 TCATGGTTGCATGGCTGGCTGGG - Intergenic
1043640833 8:82448240-82448262 TTGTGATTGCATGCCTGATTTGG + Intergenic
1047044584 8:121037920-121037942 TACAGGTTGGATGACTGGTTTGG - Intergenic
1048173252 8:132128909-132128931 GTCTGTTTGGTTGGCTGGTTTGG - Exonic
1049383608 8:142330027-142330049 TTCAGGGTGCAAGGCTGGTGTGG + Intronic
1055522193 9:77092886-77092908 TTCTGGGTGCATGCCTGATGGGG - Intergenic
1055937734 9:81618960-81618982 GTCTGGTTGGATAGATGGTTAGG - Intronic
1056514419 9:87336473-87336495 TTCTGGCTGCATGTCAGGTAGGG - Intergenic
1058585458 9:106502023-106502045 TTGTGATTGCATGGCTGACTGGG - Intergenic
1061533990 9:131236283-131236305 TTCTGGTTACAGAGCTGGTGGGG - Intergenic
1062090460 9:134675663-134675685 TTCAGGTTGAGTGGCTTGTTTGG + Intronic
1062358775 9:136177737-136177759 TTAGGGTTGCAGTGCTGGTTGGG + Intergenic
1185557677 X:1034061-1034083 TTTTGGTTGCATGGATGGTTTGG + Intergenic
1186380423 X:9052977-9052999 TTCTGGCCACATGGCTTGTTAGG - Intronic
1186380601 X:9054777-9054799 TTCTGGCCACATGGCTTGTTAGG + Intronic
1191243379 X:58206811-58206833 TCCTGTTTGAATGGCTGGGTTGG - Intergenic
1193311457 X:80015195-80015217 TTCTGGCTGCATTGCTGCCTAGG - Intronic
1200148930 X:153942076-153942098 TTCTAGTTGGGTGGCTGGGTGGG - Intronic