ID: 1070499902

View in Genome Browser
Species Human (GRCh38)
Location 10:77062932-77062954
Sequence CTTCTGGTTGCATGGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070499902_1070499910 18 Left 1070499902 10:77062932-77062954 CCAACCAGCCATGCAACCAGAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1070499910 10:77062973-77062995 CTCCCAAAGAGCTATGGTGATGG No data
1070499902_1070499907 12 Left 1070499902 10:77062932-77062954 CCAACCAGCCATGCAACCAGAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data
1070499902_1070499911 19 Left 1070499902 10:77062932-77062954 CCAACCAGCCATGCAACCAGAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1070499911 10:77062974-77062996 TCCCAAAGAGCTATGGTGATGGG No data
1070499902_1070499914 27 Left 1070499902 10:77062932-77062954 CCAACCAGCCATGCAACCAGAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070499902 Original CRISPR CTTCTGGTTGCATGGCTGGT TGG (reversed) Intronic
901185851 1:7372782-7372804 CTTCCGGTTGCAGAGCTAGTCGG + Intronic
901186167 1:7374852-7374874 CTTCTGGTCGCAGAGCTAGTCGG + Intronic
902633398 1:17719325-17719347 CTGCTGGTGGTGTGGCTGGTTGG + Intergenic
902853651 1:19182580-19182602 ATTCTTGATGCATTGCTGGTGGG - Intronic
902980127 1:20116481-20116503 CTCCTGGTTGCTGGGCTGCTTGG - Intronic
904346872 1:29878498-29878520 CTGCTGGGTCCATGCCTGGTTGG - Intergenic
904984984 1:34538217-34538239 CATCTCCTTGCCTGGCTGGTGGG + Intergenic
905725885 1:40251725-40251747 CTTCTACTTGTATGGATGGTGGG + Intergenic
906410314 1:45573609-45573631 GCTCTGGTTGCATGTCTGTTTGG + Intergenic
908563764 1:65333342-65333364 CTTCTGATTGCATTGCTCTTTGG + Intronic
908646394 1:66282674-66282696 CTTCTGGTTACACACCTGGTTGG - Intronic
910577794 1:88786170-88786192 CTTCTGGTCCCATGACTGATTGG - Exonic
913103563 1:115592380-115592402 GCTCTGGTTGCATGACTGTTTGG - Intergenic
913514390 1:119590791-119590813 CTGCAGGTTCCATGTCTGGTGGG + Intergenic
915357835 1:155266945-155266967 CTCCTTGTTGGATGGCTGATGGG - Intronic
919013340 1:191993855-191993877 CCTCTGGTAGCATTACTGGTGGG - Intergenic
919926852 1:202195919-202195941 CTTCTGCCAGCATGGATGGTAGG - Intronic
919980105 1:202637683-202637705 CTCCTGGCTGCAGGGCTGGCTGG + Intronic
920739388 1:208565968-208565990 CATTTGGTGGCTTGGCTGGTGGG + Intergenic
922334967 1:224611651-224611673 CTCCTGGCTGCATGGTGGGTGGG + Intronic
922477150 1:225914422-225914444 CTTCTGCTTGAATGTCAGGTTGG - Intronic
924279665 1:242423662-242423684 CTTCTGGTGAGATGGCTGATGGG - Intronic
924483002 1:244453560-244453582 CTTCTGGATCCATTGCTGGAGGG - Intergenic
1063306916 10:4910973-4910995 GCTCTAGTTGCATGACTGGTTGG - Intergenic
1064575931 10:16746462-16746484 TTTCTGGTTGCTTGGCTTCTAGG - Intronic
1065971607 10:30810249-30810271 TCTCTAGTGGCATGGCTGGTAGG + Intergenic
1068116565 10:52742855-52742877 CTGCAGTCTGCATGGCTGGTGGG + Intergenic
1069677453 10:70258780-70258802 CTTATGGTCACATGGCTGTTTGG + Intronic
1070499902 10:77062932-77062954 CTTCTGGTTGCATGGCTGGTTGG - Intronic
1070761485 10:79027021-79027043 GTTCTGGTTGGTTGGTTGGTTGG - Intergenic
1070784961 10:79157573-79157595 CTGGTGGGTGCATGGCTGGAGGG + Intronic
1070856643 10:79612120-79612142 CTTCAGTCTGCAGGGCTGGTGGG + Intronic
1073500498 10:103932557-103932579 CTTCTGTTTGCTTGGTTGGTTGG - Intergenic
1076267133 10:129117610-129117632 GTGCTGGTTGCAAGGCTGGAGGG - Intergenic
1077584991 11:3444381-3444403 CTTGTGCTTGCCTGGCTGCTAGG - Intergenic
1078084727 11:8226974-8226996 CCTCTGGTTGCAGAGCTGGCAGG + Exonic
1078713146 11:13814465-13814487 CTCATGGTTGCATGGCTGCCTGG - Intergenic
1078869616 11:15331135-15331157 TTTCTGATTGCATTGCTGGTGGG - Intergenic
1081745802 11:45471480-45471502 CGTCTGCTGGCATGGCTGCTTGG + Intergenic
1082781376 11:57290159-57290181 CTTCTGGATGGATGGATGGATGG + Intergenic
1083278437 11:61610858-61610880 CTCCTGGTTCCATGGCTGAAAGG - Intergenic
1084241891 11:67826951-67826973 CTTGTGCTTGCCTGGCTGCTAGG - Intergenic
1084830449 11:71764905-71764927 CTTGTGCTTGCCTGGCTGCTAGG + Intergenic
1085829469 11:79884175-79884197 TTTCTTGGTGCAGGGCTGGTTGG + Intergenic
1086782141 11:90920801-90920823 CTCCTGATTGCATGGCTGACTGG - Intergenic
1088126317 11:106428502-106428524 CTTCTGGTAACATGGCAGGAAGG + Intergenic
1091088565 11:132747542-132747564 CTTTTGGTTGCAAGGTTGGCTGG - Intronic
1092055809 12:5507168-5507190 CTTTGTGTTGCATGCCTGGTGGG + Intronic
1092412136 12:8261642-8261664 CTTGTGCTTGCCTGGCTGCTAGG - Intergenic
1092693634 12:11144395-11144417 CTTCAGTTTGCATGGTTGCTGGG - Intronic
1092918913 12:13213466-13213488 CTTCTGGTTTCAGGTCTGGTTGG + Exonic
1097519442 12:60648514-60648536 CTTCCAGTTCCATAGCTGGTGGG - Intergenic
1100041683 12:90327179-90327201 CTTCTGGATGCATAGCTGATTGG - Intergenic
1101001589 12:100362832-100362854 CTTCTGTTTGCTTGTCTGATGGG + Intronic
1104918669 12:132279318-132279340 CTTTTGCTTGCATGGTTGCTGGG + Intronic
1107351821 13:39522741-39522763 CTTGTGGTTGCCTGTCTGGGAGG - Intronic
1107658231 13:42613590-42613612 GTTGTGGTTGCATTCCTGGTGGG + Intergenic
1108505439 13:51108467-51108489 GTTCAGGCTTCATGGCTGGTGGG - Intergenic
1109388759 13:61666912-61666934 GCTCTGGTTGCATGACTGTTTGG + Intergenic
1111079194 13:83279699-83279721 GCTCTGGTTGCATGACTGTTTGG - Intergenic
1112313292 13:98339215-98339237 CTTCAGGAAGCATGGCTGGGAGG + Intronic
1112651513 13:101403933-101403955 CTTCTGCTAGCAATGCTGGTTGG - Intronic
1114818721 14:25990834-25990856 CTCCTGATTGCATGGCTGACTGG - Intergenic
1116834664 14:49758435-49758457 CTCATGATTGCATGGCTGATTGG + Intergenic
1118357828 14:65029875-65029897 CCTCTGGTTTCAGGGCTGGAGGG + Intronic
1120909387 14:89652057-89652079 GATCTGCTTGTATGGCTGGTGGG - Intergenic
1120922888 14:89771197-89771219 GCTCTGCTAGCATGGCTGGTTGG + Intergenic
1121016712 14:90553382-90553404 GTTCTGCTTCCATAGCTGGTTGG - Intronic
1124495719 15:30185728-30185750 CTCCTGGCTGCAGGGCTGGCTGG + Intergenic
1124747854 15:32352918-32352940 CTCCTGGCTGCAGGGCTGGCTGG - Intergenic
1127760868 15:62137875-62137897 CTTCTTCTTCCATAGCTGGTGGG - Intergenic
1128244825 15:66126005-66126027 CCCCTGGTTTCATGGCTGGGTGG + Intronic
1129858353 15:78841137-78841159 CTTCTGGTTCCATCCCTTGTGGG + Intronic
1131006676 15:88984079-88984101 CTTCTTGTTCCCTGGCTGCTAGG - Intergenic
1132060571 15:98689164-98689186 TTTTTGGTTGCTTGGTTGGTTGG + Intronic
1132391199 15:101439393-101439415 GTTCTAGTGGCATGGCTGCTAGG - Intronic
1134359952 16:13522085-13522107 CTTAGGATTCCATGGCTGGTGGG - Intergenic
1138797992 16:59993329-59993351 CTTCTGTTTGCATGGGAGCTGGG - Intergenic
1144139711 17:12336695-12336717 CTTCTGTTTGCATGGGAGCTGGG - Intergenic
1146538056 17:33670291-33670313 CCTCTAGCAGCATGGCTGGTGGG - Intronic
1146841049 17:36154522-36154544 TCTCTGGTTGCTTGGCTGGCTGG + Intergenic
1146853295 17:36242168-36242190 TCTCTGGTTGCTTGGCTGGCTGG + Intronic
1146869203 17:36366058-36366080 TCTCTGGTTGCTTGGCTGGCTGG + Intronic
1147072077 17:37966689-37966711 TCTCTGGTTGCTTGGCTGGCTGG + Intergenic
1147083603 17:38046221-38046243 TCTCTGGTTGCTTGGCTGGCTGG + Intronic
1147099549 17:38170188-38170210 TCTCTGGTTGCTTGGCTGGCTGG + Intergenic
1149678027 17:58484572-58484594 TTTCAGGTTGCATGTCTGGTGGG - Intronic
1150082560 17:62253482-62253504 TCTCTGGTTGCTTGGCTGGCTGG + Intergenic
1151670899 17:75571178-75571200 CTGCTGCCTGCCTGGCTGGTAGG + Intronic
1152890901 17:82881111-82881133 CGTCTGTTTGCAAGGCTGGCTGG + Intronic
1153152543 18:2111492-2111514 CTTCTGGCTGGGTGGCTGGGTGG - Intergenic
1153277752 18:3384574-3384596 CATCATGTTGCATGGCTGGATGG + Intergenic
1153733067 18:8034977-8034999 CTTCTGCTGACATGGCTGATTGG + Intronic
1155860404 18:30890869-30890891 GTTTAGGATGCATGGCTGGTTGG - Intergenic
1157304693 18:46508396-46508418 GTTCTGGGTGCATGTCTGGGTGG - Intronic
1161967150 19:7555099-7555121 CTTCTAGGGGCGTGGCTGGTGGG + Intronic
1162490116 19:10986723-10986745 CTTCTGGGTGCTCGGGTGGTGGG + Intronic
1162517536 19:11157995-11158017 TTCCAGGTTGCTTGGCTGGTTGG - Intergenic
1164748411 19:30632674-30632696 CTTCTGGTTGGTTGGTTGGTTGG - Intronic
1164961647 19:32436117-32436139 CTGCAGGTTGCATGGCAGGAGGG + Intronic
1165917606 19:39270018-39270040 TCTCAGGTTGCATGACTGGTGGG - Exonic
926207507 2:10844548-10844570 TTGCTGGTTGCAGAGCTGGTGGG + Intergenic
928914452 2:36456555-36456577 CATCTGCTTTCACGGCTGGTAGG - Intronic
932696266 2:73959429-73959451 CTTCTTCATGCATGGCAGGTAGG - Intergenic
933317551 2:80733901-80733923 GTTTTGGTGGCCTGGCTGGTGGG - Intergenic
936525280 2:113236981-113237003 ACCCTGGTTGGATGGCTGGTCGG + Intronic
939572426 2:143856333-143856355 CTTCTCATTGCATGGCTTCTTGG - Intergenic
942620368 2:177838649-177838671 GTTCTGGTTGCATGACCGTTTGG + Intronic
942758570 2:179370744-179370766 TTTCTGGTGGCTTGGCTGGTGGG + Intergenic
944009207 2:194952834-194952856 CCTCTGGTTGCATAGTTTGTTGG - Intergenic
947903520 2:233742645-233742667 CTTGGGGTTACATGGTTGGTCGG - Intronic
1168980833 20:2002448-2002470 TTTCTGATTGCATGGCTGGTTGG - Intergenic
1169099426 20:2933433-2933455 CTTTTGGTTGGTTGGTTGGTTGG + Intronic
1169401300 20:5282823-5282845 CTTCTGATTGCATGGGAGCTGGG + Intergenic
1174309823 20:49643529-49643551 CTTCTGATTGCATGCCTCGGTGG - Exonic
1175219156 20:57407132-57407154 GTCCTGGTTGCATGTCTGGGAGG - Intronic
1175386099 20:58596265-58596287 CGTCTAGCTGCAAGGCTGGTTGG - Intergenic
1177195608 21:17900997-17901019 CTTCAGTTTGCATGGGAGGTGGG - Intergenic
1177414441 21:20776191-20776213 GCTCTGGTTGCATGACTGTTTGG + Intergenic
1177847390 21:26306314-26306336 CTTCAGATTGCATGGCAGCTGGG + Intergenic
1178619514 21:34161481-34161503 GTTCTGGTTGCATGACCGCTTGG + Intergenic
1179123852 21:38574057-38574079 CTTCTGGTTGCCTGGAGGGGTGG + Intronic
1179581027 21:42344106-42344128 CTTCTGGTTTCATGCCTCTTCGG - Intergenic
1183033311 22:35121585-35121607 CTCTTGGTTTTATGGCTGGTGGG + Intergenic
1184504869 22:44894638-44894660 CTTCTGCGTGCATGGTTGGAAGG - Intronic
1184890352 22:47375371-47375393 CTGCTGGTGGCCTGGCTGCTGGG - Intergenic
949231404 3:1755106-1755128 CTTATGCATGCATGGCTGATAGG + Intergenic
950442770 3:13019556-13019578 CTCCTGGCTGGCTGGCTGGTTGG + Intronic
951324883 3:21289612-21289634 GTTCCAGTTGCATAGCTGGTAGG + Intergenic
953524010 3:43672068-43672090 CTTCCTGTTGCATGACTGCTGGG + Intronic
953612700 3:44460908-44460930 CTTCTGGATCCATCGCTGGAGGG - Intronic
954362893 3:50131736-50131758 GTTCTGGCTGCCTGGCTGTTTGG + Intergenic
955260700 3:57387495-57387517 CTTCTACTTGCATGTCTAGTAGG + Intronic
955525744 3:59818014-59818036 CTTCTGGTTCTGAGGCTGGTGGG + Intronic
955820613 3:62891952-62891974 AATCTGGTTGCATGATTGGTGGG + Intergenic
956580726 3:70809341-70809363 CATCTGGTTGCAAGGTAGGTTGG + Intergenic
957057349 3:75453864-75453886 CTTGTGCTTGCCTGGCTGCTAGG - Intergenic
957952656 3:87145617-87145639 GCTCTGGTTGCATGACTGTTTGG - Intergenic
959275248 3:104269787-104269809 CTTCAGTTTGCATGGAAGGTGGG - Intergenic
961614065 3:128164792-128164814 CTTCTGGGAGGAAGGCTGGTAGG + Intronic
961889701 3:130120305-130120327 CTTGTGCTTGCCTGGCTGCTAGG - Intergenic
963173967 3:142279709-142279731 CCTCTGGTTCCATGGCTGGGGGG + Intergenic
963174206 3:142281345-142281367 CCTCTGGTTCCATGGCTGGGGGG + Intergenic
963922117 3:150915936-150915958 CTTCTGGTTGCAAGGGAGGTTGG + Intronic
969753835 4:9134384-9134406 CTTGTGCTTGCCTGGCTGCTAGG + Intergenic
969813725 4:9670580-9670602 CTTGTGCTTGCCTGGCTGCTAGG + Intergenic
970468847 4:16355705-16355727 TTTCTGGTTGTCTGGCTGGACGG + Intergenic
970583997 4:17497738-17497760 CTTCTGGGTGCTTGGCTTGTTGG - Intronic
972145603 4:36020770-36020792 CCTTTGGTTGCATGCCTGGATGG + Intronic
972745174 4:41925125-41925147 CTTCTCTGTGCATGGCTGGATGG + Intergenic
975680177 4:76868213-76868235 CTTCGGGTTGCATGGGAGGTGGG + Intergenic
977956418 4:103032670-103032692 CTGCTGGTTGCATGAATTGTAGG - Intronic
980093964 4:128470745-128470767 CTTTTGGTTGCAGGGCTTTTGGG + Intergenic
981255989 4:142660794-142660816 GCTCTGGTTGCATGACTGTTTGG - Intronic
981495925 4:145392304-145392326 CTCATGATTGCATGGCTGATTGG + Intergenic
983321675 4:166202948-166202970 GCTCTGGTTGCATGACTGTTTGG - Intergenic
983906877 4:173192544-173192566 CTTCTGGTGGCATGGCAGCTTGG - Intronic
985909497 5:2867777-2867799 CTTCTGGAAGCTTCGCTGGTTGG - Intergenic
987516546 5:18917790-18917812 GTTCAGGTTGCTTGCCTGGTAGG - Intergenic
988400165 5:30751861-30751883 GTTCTGGATGCATTGCTGCTTGG + Intergenic
989201268 5:38766483-38766505 ATTCTGGTTGGATTGCTGGATGG + Intergenic
990413363 5:55562855-55562877 CTCCTGGTCGCATGGCTGACTGG - Intergenic
993793890 5:92242353-92242375 CTCCTGATTGCATGGCTGACTGG - Intergenic
996477359 5:123936812-123936834 CCTCTGGTTCCATGGCTGGGGGG - Intergenic
996793039 5:127313942-127313964 CTTTCGGTTCCATTGCTGGTGGG + Intronic
998588788 5:143455543-143455565 CTTCTGATTGCGTGGCTGACTGG + Intergenic
999389202 5:151177885-151177907 CAGCTGGTTCCATGGCTGATCGG - Intergenic
1000047410 5:157533103-157533125 GATCTGGCTGCATGGCTGGCTGG - Intronic
1000189752 5:158898856-158898878 TTTCTTTTTGCAGGGCTGGTAGG - Intronic
1002302713 5:178266564-178266586 CTTCTGCTTGCTTTCCTGGTGGG - Intronic
1002456899 5:179350454-179350476 ACTCTGGGTGCATGGCTGGGGGG + Intergenic
1003652217 6:7971450-7971472 CTTGTGATTGCATGGCTGATTGG + Intronic
1004728028 6:18329683-18329705 CTTCTTGTTGCAGGCCTTGTGGG + Intergenic
1008503695 6:52208695-52208717 CTTCAGGTTGCATGGTTGGAAGG + Intergenic
1009181029 6:60517724-60517746 CTTCAGTTTGCATGGGAGGTGGG + Intergenic
1010453680 6:76030651-76030673 GCTCTGGTTGCATGACTGTTTGG - Intronic
1016161986 6:140893865-140893887 CCTCTGGTTGCATGACTGCTTGG + Intergenic
1016205850 6:141467308-141467330 CCTCTGGTTTCATGACTGTTTGG + Intergenic
1016742441 6:147542254-147542276 CTTCTGGATCCATTGCTGGAGGG + Intronic
1017884689 6:158588956-158588978 GCTCTGTGTGCATGGCTGGTGGG + Intronic
1018114964 6:160574203-160574225 CTTCAGTTTGCATGGGTGCTGGG - Intronic
1022061317 7:26798495-26798517 CTTCCGGTTGCATTTCTTGTAGG - Intronic
1023800108 7:43826654-43826676 CTTCTGGATCCATCGCTGGAGGG - Intergenic
1024631378 7:51250221-51250243 TTTCTGGCTGCAAGGCTGTTTGG - Intronic
1025240914 7:57272860-57272882 CTTCTTCTTGCATTTCTGGTAGG + Intergenic
1028952672 7:96654547-96654569 CTCCTGATGGCATGGCTGATGGG - Intronic
1029126204 7:98296750-98296772 CTTCTGGATACAAGGCTGGCAGG + Intronic
1031080376 7:117251899-117251921 TTTCTGTGTGCATGGCTGGTTGG - Intergenic
1033035978 7:137876721-137876743 CTTCTGCTTGCTGGGCTGGCTGG - Exonic
1033536137 7:142313610-142313632 CTTCTGGCTGCAGGGCGTGTAGG - Intergenic
1034052157 7:147995169-147995191 GTTTTGGGTGCATGCCTGGTAGG - Intronic
1036198616 8:6746224-6746246 CTTATCTTTGCATGGCAGGTGGG + Intronic
1036377047 8:8209733-8209755 CTTGTGCTTGCCTGGCTGCTAGG + Intergenic
1036852497 8:12213416-12213438 CTTGTGCTTGCCTGGCTGCTAGG - Intergenic
1036873865 8:12455939-12455961 CTTGTGCTTGCCTGGCTGCTAGG - Intergenic
1039569626 8:38576402-38576424 GTTCTGGTTGCTGAGCTGGTCGG + Intergenic
1040397443 8:47013102-47013124 CCTCTGGTTCCATGGCTTGGGGG - Intergenic
1041364154 8:57083476-57083498 CTTCTGTTTGCATGGGAGCTGGG + Intergenic
1041816634 8:61980294-61980316 CTTTTGGTTGGCTGGCTGATTGG - Intergenic
1041958222 8:63580780-63580802 CTCATGGTTGCATGGCTGGCTGG - Intergenic
1044227588 8:89736855-89736877 CTTCAGTTTGCATGGCAGCTGGG + Intergenic
1045846645 8:106644867-106644889 ATTCTGGTTCCATGGCTGTAGGG - Intronic
1049053962 8:140220427-140220449 CTTCTGTTTGCACGGCAGCTTGG - Intronic
1049800600 8:144515876-144515898 CTTCTGCTTCCATGCCTGGGGGG + Exonic
1049859331 8:144887569-144887591 TCTCTGGGAGCATGGCTGGTTGG - Intronic
1051335326 9:16060681-16060703 CTTCTGTTGGCATGGTTAGTGGG - Intronic
1052447041 9:28576203-28576225 CTTGTGATTGCATGGCTGACCGG + Intronic
1055244233 9:74220635-74220657 TTTCTGGTTGCATGGCAGCTGGG + Intergenic
1055522194 9:77092887-77092909 CTTCTGGGTGCATGCCTGATGGG - Intergenic
1056286822 9:85095441-85095463 TTTCTCCTTGCATTGCTGGTGGG - Intergenic
1056514420 9:87336474-87336496 CTTCTGGCTGCATGTCAGGTAGG - Intergenic
1056846661 9:90044088-90044110 CTTATAGTTGCATGGTTGCTGGG - Intergenic
1057077046 9:92143370-92143392 CTTCTGCCAGCATGGATGGTAGG - Intergenic
1058069051 9:100583222-100583244 CCTCTGCCTGCATGGCTAGTGGG + Intronic
1058348197 9:103990178-103990200 CTTCTGGATGTATGGGTGGGAGG - Intergenic
1058585459 9:106502024-106502046 CTTGTGATTGCATGGCTGACTGG - Intergenic
1059647792 9:116284712-116284734 CTTCTGTTTAAATGTCTGGTTGG - Intronic
1059820512 9:117967408-117967430 CCTCTGTTTAGATGGCTGGTTGG - Intergenic
1060892352 9:127196863-127196885 CTGCTGGTGGCATGGCAGGCAGG + Intronic
1061518578 9:131103992-131104014 CTTCTGGTTCTGTGGCTGGGTGG + Intronic
1061533991 9:131236284-131236306 GTTCTGGTTACAGAGCTGGTGGG - Intergenic
1062099480 9:134720742-134720764 GGGCTGGTTGCCTGGCTGGTAGG + Intronic
1062273494 9:135720280-135720302 CTTCTGCTTGGAGGCCTGGTGGG - Intronic
1062358774 9:136177736-136177758 CTTAGGGTTGCAGTGCTGGTTGG + Intergenic
1062624015 9:137434910-137434932 CTTCTGGTTGCAGGACTAGTGGG - Exonic
1186441085 X:9587183-9587205 CTTCTGGTCGGATGGCAGGGCGG + Intronic
1191883871 X:65869445-65869467 CTTCTGGTGGCAGGGCAGGGGGG + Intergenic
1192502542 X:71663390-71663412 TTTCTGGTTGCAGGGCTAGGTGG - Intergenic
1192509744 X:71714766-71714788 TTTCTGGTTGCAGGGCTAGGTGG - Intronic
1192511018 X:71720430-71720452 TTTCTGGTTGCAGGGCTAGGTGG + Intergenic
1192515679 X:71761123-71761145 TTTCTGGTTGCAGGGCTAGGTGG - Intergenic
1192516953 X:71766787-71766809 TTTCTGGTTGCAGGGCTAGGTGG + Intronic
1192528887 X:71869877-71869899 TTTCTGGTTGCAGGGCTAGGTGG - Intergenic
1192681057 X:73254461-73254483 GTTCTGGATGCATGGCCGTTTGG + Intergenic
1192765345 X:74134142-74134164 CATCTGGTTCCATGGCTTGGAGG + Intergenic
1194740866 X:97572884-97572906 CTTCTGTTTGGATGACTCGTTGG - Intronic
1195721387 X:107872204-107872226 GTTCTGGTTGCCTGACTGTTTGG + Intronic
1201749094 Y:17413109-17413131 CTTCTGGATCCATTGCTGGAGGG - Intergenic
1201768636 Y:17596332-17596354 CTTCAGTTTTCATGGCTTGTGGG - Intergenic
1201832918 Y:18309653-18309675 CTTCAGTTTTCATGGCTTGTGGG + Intergenic
1202043700 Y:20714504-20714526 CTTCAGTTTGCATGGGAGGTGGG + Intergenic