ID: 1070499903

View in Genome Browser
Species Human (GRCh38)
Location 10:77062936-77062958
Sequence ATGACTTCTGGTTGCATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070499903_1070499910 14 Left 1070499903 10:77062936-77062958 CCAGCCATGCAACCAGAAGTCAT 0: 1
1: 0
2: 0
3: 14
4: 125
Right 1070499910 10:77062973-77062995 CTCCCAAAGAGCTATGGTGATGG No data
1070499903_1070499907 8 Left 1070499903 10:77062936-77062958 CCAGCCATGCAACCAGAAGTCAT 0: 1
1: 0
2: 0
3: 14
4: 125
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data
1070499903_1070499911 15 Left 1070499903 10:77062936-77062958 CCAGCCATGCAACCAGAAGTCAT 0: 1
1: 0
2: 0
3: 14
4: 125
Right 1070499911 10:77062974-77062996 TCCCAAAGAGCTATGGTGATGGG No data
1070499903_1070499914 23 Left 1070499903 10:77062936-77062958 CCAGCCATGCAACCAGAAGTCAT 0: 1
1: 0
2: 0
3: 14
4: 125
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070499903 Original CRISPR ATGACTTCTGGTTGCATGGC TGG (reversed) Intronic
900697269 1:4020174-4020196 CTGGCTTCTTGTTGCTTGGCAGG + Intergenic
902235976 1:15057748-15057770 AGGACAGCTGGCTGCATGGCTGG - Intronic
902742300 1:18447167-18447189 ATGACTTCTGGATCCTCGGCTGG - Intergenic
904709048 1:32414675-32414697 AGTTCTTCTGGTTCCATGGCTGG + Intergenic
906824342 1:48962594-48962616 ACAACTTCTGGGAGCATGGCAGG - Intronic
912264977 1:108148313-108148335 TTTATTTCTGGTTCCATGGCTGG - Exonic
912461136 1:109832365-109832387 CTGACTTCTGGATTCATCGCTGG - Intergenic
912812937 1:112807484-112807506 ATGATTTTTGGTTTTATGGCTGG + Intergenic
913361666 1:117987733-117987755 ATAACATCTGGGTGCCTGGCAGG + Intronic
917577871 1:176343342-176343364 ATGACCCCTGGTTACATAGCTGG + Intergenic
920086431 1:203421177-203421199 CAGACTTCTTGTTGCATGGAAGG + Intergenic
920280137 1:204837057-204837079 CTGACTTGTGACTGCATGGCTGG + Intronic
923035329 1:230281287-230281309 AACACATCTGGTTGCATGGCAGG - Exonic
1062790885 10:305549-305571 ATGACTTCAGGTTACAAGCCCGG + Intronic
1063467944 10:6259903-6259925 ATGAGTGCTGGCTGAATGGCAGG + Intergenic
1064080739 10:12306151-12306173 GTGAGTTCTGGTTGGATGCCAGG + Intergenic
1065308379 10:24390253-24390275 ATGACTTCTGGAGGCTTGGCAGG + Intronic
1068709199 10:60114711-60114733 ATGACTTCTGGTTCCAAGTGGGG + Intronic
1068823720 10:61409619-61409641 ATATCTACTGGTTGCAAGGCAGG - Exonic
1069026035 10:63543030-63543052 ATTACTGCTGGATGAATGGCTGG - Intronic
1069138589 10:64796400-64796422 ATAATTTCTGGGTGGATGGCAGG - Intergenic
1069565173 10:69459180-69459202 TTGACTTCTTGTTGGAAGGCAGG + Intronic
1070499903 10:77062936-77062958 ATGACTTCTGGTTGCATGGCTGG - Intronic
1073765002 10:106672543-106672565 ATGTCATATGGTTGCATGGTGGG - Intronic
1074252641 10:111767323-111767345 ATGAGTTGTGGTTGCATGTCGGG - Intergenic
1077754801 11:5015388-5015410 GTGTCTTCTGGTTCCATGCCCGG + Intergenic
1078084725 11:8226970-8226992 CTGACCTCTGGTTGCAGAGCTGG + Exonic
1081601343 11:44496990-44497012 ATGACCTCTAGCTGCAGGGCTGG - Intergenic
1081997260 11:47373788-47373810 ATGACTCCTGATTGGATGCCTGG - Intronic
1087472173 11:98589655-98589677 ATGACTTCTGTTTACTTTGCAGG - Intergenic
1088126316 11:106428498-106428520 ATTGCTTCTGGTAACATGGCAGG + Intergenic
1088336066 11:108705294-108705316 ATGACTTCCGGCTGCATGGATGG + Intronic
1091688549 12:2580609-2580631 ATGACTGCTGGATGCAGGGTGGG - Intronic
1100713505 12:97282176-97282198 TTGAATTGTGCTTGCATGGCTGG - Intergenic
1101996314 12:109527765-109527787 ATGGCTACAGGTTACATGGCAGG - Intronic
1102060099 12:109925376-109925398 CTGGCTCCTGGTTCCATGGCTGG + Intronic
1102597993 12:114007530-114007552 ATGACTTCAGGTGACATGACTGG + Intergenic
1103132374 12:118480413-118480435 ATGTCTTCTGGTTGGAGGGGAGG + Intergenic
1103857379 12:123982274-123982296 ATGACTTCTGTTACCTTGGCAGG - Intronic
1105518171 13:21109201-21109223 ATGCCTTCTGGTCACAGGGCTGG - Intergenic
1106149862 13:27088741-27088763 CTGACTTCTGGGTGCTTGCCTGG + Intronic
1113723125 13:112575926-112575948 CTGACTGCAGGTTGCAGGGCTGG - Intronic
1114715312 14:24818143-24818165 ATGACTTGTGTTGGCATGTCAGG - Intronic
1116971670 14:51072323-51072345 AGGAATTCTCGTTGGATGGCTGG - Intronic
1120176300 14:81297093-81297115 TTGACTTCAGGTTTCAAGGCAGG + Intronic
1120896483 14:89537326-89537348 ATGACTGATGGATGCATGGATGG + Intronic
1128874762 15:71193071-71193093 ATGACTTCTAGTGGGATGGGCGG + Intronic
1130631555 15:85574354-85574376 ATGCCTTCTGGATGCAAGGGTGG + Intronic
1131045209 15:89309105-89309127 TTGACTACTGGCTGGATGGCTGG - Intronic
1140526566 16:75627956-75627978 TTGTCTTCGGGTTTCATGGCAGG + Exonic
1147537960 17:41333211-41333233 ATGCCTTCTAGATGCGTGGCCGG + Intergenic
1150805847 17:68318419-68318441 ATGACTCCTGGCTGGGTGGCTGG + Intronic
1156088048 18:33432012-33432034 ATGACTGCTGGGTGCACTGCAGG + Intronic
1156711505 18:39952222-39952244 ATGACTTCTTGATCCATGGTGGG + Intergenic
1160316116 18:77849356-77849378 CTGACTTCTGGTTGCATGCTAGG + Intergenic
1164748412 19:30632678-30632700 AGGACTTCTGGTTGGTTGGTTGG - Intronic
1165799011 19:38536283-38536305 ATGACTTCTGGTGGCGGGGGGGG - Intronic
931257498 2:60585902-60585924 TTGACTTCTTGTTGAATGACAGG - Intergenic
931782516 2:65590987-65591009 ATGACTTCCGGCTGCTGGGCTGG + Intergenic
932788061 2:74625714-74625736 ATGAATTCTGAATGCATGGATGG - Intronic
934514896 2:94980608-94980630 TTGCCTTCTGGTAGCATGCCTGG - Intergenic
937570901 2:123359837-123359859 TTGACCTCTGATTACATGGCTGG + Intergenic
938844741 2:135196763-135196785 ATGACATCTAGTTGCAGGGAAGG + Intronic
939314458 2:140529817-140529839 TCCTCTTCTGGTTGCATGGCAGG - Intronic
939588910 2:144039429-144039451 ATGTCTTCTGGTTTCTAGGCGGG + Intronic
940326672 2:152432925-152432947 AAGTTTTCAGGTTGCATGGCAGG + Intronic
945603905 2:211903373-211903395 ATGATTTTTGGGTGCAAGGCAGG + Intronic
947771843 2:232676364-232676386 GTGACTCCTGGCTGCATGGGAGG + Intronic
1169119860 20:3088878-3088900 TTGACTTCTGGATAAATGGCAGG - Intergenic
1172976111 20:38907280-38907302 ATGAGGTCTGGTTGAATGGATGG + Intronic
1173623509 20:44454547-44454569 AAGACTTCTGGGAGCCTGGCCGG + Intronic
1174132253 20:48353905-48353927 CAGACTTCTTGATGCATGGCAGG - Intergenic
1184670607 22:46010631-46010653 ATGACTCCTGCTTTCATGGCAGG - Intergenic
954958730 3:54546005-54546027 ATGTCTTCTGACTGCATGGACGG - Intronic
962089805 3:132231124-132231146 CTGACTTCTGGCTCCATGCCTGG + Intronic
963189544 3:142454038-142454060 ATGACTTCTGGTTGCTCTGCAGG + Intronic
963922116 3:150915932-150915954 GTGGCTTCTGGTTGCAAGGGAGG + Intronic
965704171 3:171489345-171489367 ATGACTTTTAGGTGGATGGCTGG + Intergenic
967544722 3:190711693-190711715 AGCACTTCTTGTTTCATGGCTGG + Intergenic
968604401 4:1525311-1525333 CTGACTTCTGGTTGCACTTCTGG + Intergenic
969205351 4:5639994-5640016 ATGAATTCTGGATGGATGGATGG + Intronic
971481338 4:27117476-27117498 ATGACTTCTCATTGCATCCCAGG + Intergenic
972218293 4:36922106-36922128 ATGACTTCTGATTGCAGGCCTGG + Intergenic
973775217 4:54235470-54235492 TTTACTTCTGTTTGCAGGGCAGG + Intronic
973777020 4:54252933-54252955 TTTACTTCTGTTTGCAGGGCAGG + Intronic
980642358 4:135596885-135596907 AGTTCCTCTGGTTGCATGGCTGG + Intergenic
980847285 4:138339053-138339075 ATCACTTCTGGCTGCATTCCAGG - Intergenic
983453698 4:167936586-167936608 ATGTCTTTTGGATGGATGGCTGG + Intergenic
987396142 5:17425818-17425840 ATTATTACTGGTTACATGGCTGG - Intergenic
990117964 5:52412327-52412349 ATGACTGCTGGTTTTGTGGCTGG - Intergenic
990366238 5:55073449-55073471 TTAACTTTTGGTTTCATGGCTGG + Intergenic
992238623 5:74740218-74740240 AGGAGTGCTGGTTACATGGCTGG - Intronic
994676567 5:102830108-102830130 GTGACAACTGGTTGCATGGCTGG + Intronic
994730075 5:103481479-103481501 GTGCATTCTGGGTGCATGGCTGG - Intergenic
996069633 5:119120193-119120215 ATCACTTCTGTTTTCAGGGCCGG - Intronic
999839963 5:155414120-155414142 ATGACTTCTCATATCATGGCAGG + Intergenic
999923394 5:156347454-156347476 TTGACTTCTGGTTGGATGTAGGG + Intronic
1004509914 6:16277110-16277132 ACAACGTCTGGTTGCAGGGCGGG + Intronic
1004952290 6:20687018-20687040 TTTACCTCTGATTGCATGGCTGG - Intronic
1005948854 6:30616433-30616455 TTGATTTCTTGTTGCAAGGCTGG + Intronic
1010889914 6:81293947-81293969 ATGACTACTGGTTGCTTCACTGG - Intergenic
1011706179 6:90003567-90003589 ATGTCTCCTGGTTACATAGCAGG + Intronic
1013456495 6:110334266-110334288 ATGACTTCTGGTTTAAAGCCTGG - Intronic
1015955813 6:138596918-138596940 TTAACTTCTGATTGCAAGGCGGG - Intronic
1017300377 6:152850673-152850695 AGGACTTCAGTTTGCATTGCAGG + Intergenic
1020215685 7:6188422-6188444 GTGACAACTGTTTGCATGGCAGG - Intronic
1020320622 7:6936478-6936500 GTGACCTCGGGGTGCATGGCAGG - Intergenic
1022239295 7:28493721-28493743 CTGACTTCTGGTCACATGGTGGG - Intronic
1022601321 7:31762920-31762942 ACAACTTCAGGTTGCATGGAAGG - Intronic
1026353092 7:69534582-69534604 ATGACCTCAGGTTGCATGAGAGG + Intergenic
1028939777 7:96508389-96508411 AACACTTCTGGTGGCAGGGCAGG + Intronic
1029926734 7:104327327-104327349 AAGCATTCTGGTTTCATGGCTGG + Intergenic
1032489803 7:132315889-132315911 ATGACTTTTGGGGGCATGGTGGG + Intronic
1032767077 7:135006242-135006264 ATGACTTCTGGTGGAATTTCTGG - Intronic
1032900559 7:136302396-136302418 ATAACTTCTGGTGGCCTGCCTGG + Intergenic
1034315189 7:150124338-150124360 ATGACTTCTGGATCCCTGGAGGG + Intergenic
1034791703 7:153976461-153976483 ATGACTTCTGGATCCCTGGAGGG - Intronic
1038547699 8:28438456-28438478 ATGCCTTCTGGCTGCCTGGCAGG + Intronic
1041504694 8:58583072-58583094 ATGAGTTCCTGCTGCATGGCAGG - Intergenic
1046541148 8:115585552-115585574 ATGGCTTCTGGTTATAAGGCGGG - Intronic
1047024130 8:120808957-120808979 ATGTAATCTGGTTGTATGGCAGG - Intronic
1047252751 8:123193014-123193036 AAGACTGCTGGTGGCTTGGCAGG - Intronic
1047786106 8:128155306-128155328 ATGACTGCTGCTTGAATGGATGG + Intergenic
1050872323 9:10588521-10588543 ATGAGTTCTGATTCCATGGCTGG - Intronic
1051641565 9:19229596-19229618 ATGACTTCAGATTCCATGGCAGG - Intergenic
1052414036 9:28155241-28155263 ATGACTTCTAGATTCCTGGCTGG - Intronic
1054928984 9:70617143-70617165 CTGAATTCTGGGTGCCTGGCCGG + Intronic
1057140336 9:92722890-92722912 TTGAGTTCTGGCTGTATGGCTGG - Intronic
1057429458 9:94980397-94980419 CTGGTTTCTGGTTTCATGGCTGG + Intronic
1058272331 9:102987680-102987702 ATGGCTTTTGGTTACATGGATGG - Intergenic
1058884420 9:109312770-109312792 ATGAGTTCTGGCTGTATGCCTGG - Intronic
1060185777 9:121563220-121563242 CTGGCTTCTGTTTGCCTGGCAGG + Intergenic
1060277307 9:122191881-122191903 AGGACTTCTGGTTCCCTGCCAGG - Intronic
1185557676 X:1034056-1034078 ATGTTTTTTGGTTGCATGGATGG + Intergenic
1186322875 X:8449339-8449361 AATACTTCTGGTTGCAAAGCTGG - Intergenic
1186404763 X:9292052-9292074 ATCACTTCTGATTGCAGGGTGGG + Intergenic
1189221789 X:39378351-39378373 AGGCCTTCTGATTGCTTGGCTGG + Intergenic
1192964028 X:76158713-76158735 ATGACTTTTTGTTGCATGAATGG - Intergenic
1198676839 X:139140309-139140331 ATGACTTCTGGGTGTCTGGCTGG - Intronic
1199303179 X:146236482-146236504 ATGACTTCTAATTGCAAGGCAGG + Intergenic