ID: 1070499904

View in Genome Browser
Species Human (GRCh38)
Location 10:77062940-77062962
Sequence GAAGATGACTTCTGGTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070499904_1070499910 10 Left 1070499904 10:77062940-77062962 CCATGCAACCAGAAGTCATCTTC 0: 1
1: 0
2: 1
3: 25
4: 216
Right 1070499910 10:77062973-77062995 CTCCCAAAGAGCTATGGTGATGG No data
1070499904_1070499911 11 Left 1070499904 10:77062940-77062962 CCATGCAACCAGAAGTCATCTTC 0: 1
1: 0
2: 1
3: 25
4: 216
Right 1070499911 10:77062974-77062996 TCCCAAAGAGCTATGGTGATGGG No data
1070499904_1070499914 19 Left 1070499904 10:77062940-77062962 CCATGCAACCAGAAGTCATCTTC 0: 1
1: 0
2: 1
3: 25
4: 216
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data
1070499904_1070499907 4 Left 1070499904 10:77062940-77062962 CCATGCAACCAGAAGTCATCTTC 0: 1
1: 0
2: 1
3: 25
4: 216
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070499904 Original CRISPR GAAGATGACTTCTGGTTGCA TGG (reversed) Intronic
902547363 1:17198545-17198567 GAACATGACTGCTTGTGGCAAGG + Intergenic
903938717 1:26914043-26914065 GAACATGACTTCTGGAGTCAAGG - Intronic
904709408 1:32417434-32417456 TAAGATAACTTCTGGTAGCATGG + Intergenic
905707016 1:40068062-40068084 GAAGATGCATACTGGTTACATGG + Intronic
907543274 1:55236103-55236125 AAAGATGACCTCTGTTTTCAAGG + Intergenic
907716430 1:56930508-56930530 GAAGATGACTGCTAGGGGCATGG + Intronic
908163263 1:61432695-61432717 GAAGATGAGGTAGGGTTGCAGGG - Intronic
912461427 1:109834752-109834774 TAAGATAACTTCTGGTAGCTTGG + Intergenic
915403200 1:155639312-155639334 TAGGATGACTTCTGGTGGCCTGG - Intergenic
915664903 1:157435462-157435484 TAAAATGACTTCTGGTGGCCTGG + Intergenic
916182173 1:162094871-162094893 GAAGATGACATGTGGCTGCCTGG - Intronic
916239021 1:162620975-162620997 AAAGAGGACTTCTTGTTGGATGG - Intergenic
918734383 1:188039492-188039514 GAGGATGAATCCTAGTTGCATGG - Intergenic
919129563 1:193436156-193436178 TAAGACAACTTCTGTTTGCAGGG + Intergenic
920640231 1:207744718-207744740 TAAGATAACTTCCGGTAGCATGG + Intergenic
922678968 1:227574439-227574461 AAATATGATTTTTGGTTGCATGG + Intronic
923865295 1:237933143-237933165 GAAGATGACCACTGGTGGCCTGG - Intergenic
924808625 1:247381741-247381763 TGAGATGACTTCTGGTAGCCTGG - Intergenic
1063745330 10:8873128-8873150 AAAGATGCTTTCTGTTTGCAGGG + Intergenic
1067059767 10:43072246-43072268 TGAGAAGGCTTCTGGTTGCATGG + Intergenic
1068496689 10:57791999-57792021 TAAGATAACTTCTGGTAGCATGG + Intergenic
1069151900 10:64972701-64972723 GAAGATTCCTTTTGGTTTCAGGG - Intergenic
1070499904 10:77062940-77062962 GAAGATGACTTCTGGTTGCATGG - Intronic
1071357264 10:84810630-84810652 TAAGATGACTTCTGGTAGCCTGG - Intergenic
1072222128 10:93335415-93335437 GAAGATCAGATTTGGTTGCATGG + Intronic
1073417267 10:103395001-103395023 GAAGACTAATTCTGATTGCAGGG + Intronic
1074706492 10:116137548-116137570 GCAGATGAGTGATGGTTGCAGGG - Intronic
1074846215 10:117400531-117400553 GAAGGTGATTTGTGGTTGCTGGG - Intergenic
1077720559 11:4624404-4624426 TAAGATAACTTCTGGTAGCATGG - Intergenic
1080916877 11:36668801-36668823 TAAGATAACTTCTGGTAGCATGG + Intergenic
1081769833 11:45643107-45643129 GCTGATGACTTCTGATTGAATGG - Intergenic
1083385010 11:62301484-62301506 TAAGATAACTTCTGGTAGCATGG + Intergenic
1084507512 11:69577659-69577681 TAAGATGACGTGTGGTTGCCAGG - Intergenic
1084532148 11:69733865-69733887 GAAGATGGACTCTGGCTGCAGGG - Intergenic
1084928969 11:72538612-72538634 GGAGGTGACTTCAGGGTGCAAGG + Intergenic
1085725027 11:78947674-78947696 GAGGATCACTTCTGGTGCCAAGG + Intronic
1086058820 11:82679761-82679783 TAAGATAACTTCTGGTAGCATGG - Intergenic
1088019715 11:105104836-105104858 TAAGATAACTTCTGGTAGCCTGG + Intergenic
1090291670 11:125551346-125551368 TAAGATAACTTCTGGTAGCATGG - Intergenic
1091719711 12:2803762-2803784 GATGATGTCTTCTGGTGTCATGG + Exonic
1092509749 12:9142904-9142926 TAAAATGACTTCTGGTGGCCTGG - Intergenic
1092628230 12:10351199-10351221 GTAGATCACTTTAGGTTGCACGG + Intergenic
1093101513 12:15034977-15034999 TAAGATCACTTCTGGTAGCCTGG - Intergenic
1093312366 12:17605598-17605620 GAAGATGAACTCTCCTTGCAAGG + Intergenic
1094431340 12:30373136-30373158 TAAGATAACTTCTGGTAGCCGGG - Intergenic
1096572586 12:52532382-52532404 CAAAATCACTTCAGGTTGCATGG - Intergenic
1096879886 12:54658883-54658905 GAAGATGCTTTCTGGAGGCATGG - Intergenic
1100910462 12:99355542-99355564 GAAGCTCACTTCTGTTTGCTTGG + Intronic
1101383712 12:104236970-104236992 TAAGATAACTTCTGGTAACATGG + Intronic
1102130672 12:110526271-110526293 GAAGTTAATTTCTAGTTGCATGG + Intronic
1105939397 13:25133819-25133841 GCAGATGATTTCAGGTTGTAAGG - Intergenic
1106219151 13:27730690-27730712 GAAGTTGTCTTCTGGTTGAAGGG - Intergenic
1109040653 13:57331500-57331522 GAGGATGGCTTCTGGTTCCTGGG + Intergenic
1110953142 13:81520091-81520113 TAAGATAACTTCTGGTAGCATGG - Intergenic
1112357253 13:98684198-98684220 GAAGAAGTCTTCTGTTTGAAAGG - Exonic
1113700809 13:112386557-112386579 TAAGATAACTTCTGGTAGCCGGG - Intronic
1115190248 14:30740194-30740216 GAAGCAGATTTGTGGTTGCAGGG + Intergenic
1117138600 14:52763772-52763794 GAAGATGCATTCTGTTTTCAGGG + Intronic
1119232663 14:72993155-72993177 GAAGATGACTCCCGGGTGCCGGG + Exonic
1119261211 14:73238820-73238842 TAAAATGACTTCTGCTTACAAGG - Intronic
1119305517 14:73605010-73605032 TAAGATAACTTCTGGTAGCCTGG - Intergenic
1120176299 14:81297089-81297111 GGAGTTGACTTCAGGTTTCAAGG + Intronic
1120522202 14:85536669-85536691 GAAGATGACGTCAGGGTGCTGGG + Intronic
1120838435 14:89061912-89061934 GAATGTGACTTCTGGATGCTTGG + Intergenic
1121321962 14:92996954-92996976 AAAGATGGCCTCTGGTTCCAAGG + Intronic
1124715591 15:32058153-32058175 GAAGATGATGTGTGGCTGCAGGG + Intronic
1127402924 15:58609144-58609166 GAAGTTGTCTTCTGGTACCATGG - Intronic
1127685787 15:61342304-61342326 GATGATGACTTCTCATTTCATGG + Intergenic
1128304856 15:66591659-66591681 AAAGATGACATGTGCTTGCAGGG + Intronic
1128640554 15:69333174-69333196 TAAGATAACTTCTGGTAGCCTGG + Intronic
1129778609 15:78253951-78253973 CAAGATGACAGCTGGTTGCCAGG + Intergenic
1130854454 15:87829285-87829307 GCTGATGTCTTCTGGTGGCAAGG - Intergenic
1131702626 15:94955751-94955773 CATGATGACTTTTGGTTGCTTGG + Intergenic
1132465250 16:74491-74513 GAAGGTGACTCCTGGGTGCGGGG - Intronic
1134170436 16:11964187-11964209 GGTGATGACTTCTGGATGCTTGG + Intronic
1134335213 16:13292862-13292884 AAAGATGACTTCTGGGATCAAGG - Intergenic
1138124242 16:54425783-54425805 GAAGCTCACTTCTGGGTACAGGG - Intergenic
1138610968 16:58123691-58123713 AAACATTACTTCTGGTTGTAAGG - Intronic
1138906431 16:61340719-61340741 GAAGCTGAGCTCTGGTTGGAGGG + Intergenic
1138948110 16:61876574-61876596 GAAGAAGGCCTCTGCTTGCACGG + Intronic
1138967598 16:62104074-62104096 GTAAATGACTGCTGGTTGCCTGG + Intergenic
1139207455 16:65043121-65043143 GAAAAGGACCTCTGGTTACAAGG - Intronic
1140667109 16:77237753-77237775 ACAGATGACTGCTGGCTGCAAGG + Intergenic
1144335953 17:14269103-14269125 GGAGATGAGTTCTGGTAGGAAGG - Intergenic
1144593242 17:16542731-16542753 TAAGATAACTTCTGGTAGCATGG + Intergenic
1146405367 17:32532240-32532262 GCAGATCATTTCTGGTTGAAAGG - Intronic
1146742612 17:35299677-35299699 CAAAATGACTTCTGGTGGCCTGG + Intergenic
1148633173 17:49127858-49127880 TAAAATGACTTCTGGTGGCCTGG - Intergenic
1149835968 17:59912863-59912885 GAAGATGACTGCTGGAACCAGGG - Intronic
1150252270 17:63713063-63713085 GAAGATGGCCACTGGTGGCAGGG + Intronic
1150751725 17:67870136-67870158 GAGGATAACTGCAGGTTGCAAGG - Intronic
1151515726 17:74594110-74594132 GCAGATGGCTTTTGGTTACAAGG - Exonic
1153587738 18:6640805-6640827 GAAGATGACTTAAGGTCACAGGG - Intergenic
1153824466 18:8862841-8862863 GAAGACGACCTCTGGCTGAAGGG - Intergenic
1154256646 18:12787010-12787032 TAAAAAGACTTCTGGATGCATGG - Intronic
1160605700 18:80048114-80048136 CAAGATAACTTCAGGTTACAAGG + Intronic
1161781308 19:6294070-6294092 CAGGATGACTTCTGGTGGCCTGG + Intergenic
1162746833 19:12803426-12803448 GAAGCTGACTTCTGTCTTCAGGG - Intronic
1162764362 19:12909397-12909419 GAAGATGAAATCGGGTTGCCTGG - Intronic
1164629739 19:29754217-29754239 GGAAATGACTTCTTGGTGCAAGG - Intergenic
1168077393 19:53988754-53988776 GAAGATGAATTCAGGGGGCAGGG + Exonic
925161079 2:1684934-1684956 GAAAATGTGTGCTGGTTGCAGGG - Intronic
925371876 2:3351588-3351610 GAAGATGGCCTGTGGTTTCAGGG - Intronic
927969784 2:27298319-27298341 AAAGCTGAGTTCTGGATGCAGGG + Intronic
929558114 2:42938011-42938033 GAAGATGAGTTCTGGTTGGACGG - Intergenic
929993714 2:46811898-46811920 AAAGATCACTTCTGAGTGCAGGG - Intergenic
930725507 2:54677626-54677648 GGAGCTGACTTCTGGATGCCTGG + Intergenic
932205178 2:69874173-69874195 GAAGTAGAATTCTTGTTGCATGG + Intronic
933376387 2:81484742-81484764 GAAAATGATTTCTGGTTGTGAGG + Intergenic
933599669 2:84316770-84316792 GAATATGACTCCTGGGTGCTGGG + Intergenic
935365402 2:102284234-102284256 GAAGATGACTACTGGGTTCTTGG - Intergenic
935941375 2:108242809-108242831 AAAGATAACTTCTGGTAGCATGG - Intergenic
937459825 2:122076117-122076139 GTAGAAGACCTCTGGATGCATGG + Intergenic
938844740 2:135196759-135196781 AATGATGACATCTAGTTGCAGGG + Intronic
939653431 2:144792130-144792152 GAAGGTGCCTTCTACTTGCAGGG + Intergenic
940905162 2:159162434-159162456 GATGATGACCTGTGGTTGCAAGG + Intronic
942171677 2:173295796-173295818 CAAGATAACTTCTGGTGGCCTGG - Intergenic
945603904 2:211903369-211903391 GAAAATGATTTTTGGGTGCAAGG + Intronic
947670949 2:231934958-231934980 GGAGATGGCCTCTGGTTTCAGGG + Intergenic
948359140 2:237406154-237406176 GAATATGATTTCAGGTTGAAGGG - Intronic
1168986723 20:2055683-2055705 CAAGATGACATCTGGATGTAGGG + Intergenic
1169044252 20:2523614-2523636 GAAGTTGACTTGAAGTTGCAAGG + Intronic
1169335714 20:4754715-4754737 GTAGATTACTTCTGGTAGTATGG + Intergenic
1170906685 20:20521679-20521701 CAAGATGATTTGTGTTTGCATGG - Intronic
1171260379 20:23726780-23726802 GAAATTGAATTCTGGTTACAAGG - Intergenic
1171269492 20:23802594-23802616 GAAATTGAATTCTGGTTACAAGG - Intergenic
1175094940 20:56533795-56533817 GAAGATGACCTCTAGTTTCTTGG + Intronic
1176896495 21:14384288-14384310 GAAGCTGAATTCTGGTTGATAGG + Intergenic
1177015924 21:15787170-15787192 GGAGATGACTTCAGGTAGTATGG - Intronic
1179466704 21:41580745-41580767 GAAGAAGCCTTCTGATTGAAAGG + Intergenic
1181411916 22:22730139-22730161 GAAGAGGACCTCTGGATACAAGG - Intergenic
1181446389 22:22978507-22978529 TAAGATAACTTCTGGTAACATGG + Intergenic
1184912401 22:47544951-47544973 GAAGACTACTTCTGCTTGCAGGG + Intergenic
1185398819 22:50605629-50605651 GAGGACGACTTCTGGTTCCGTGG + Exonic
949213779 3:1539127-1539149 TCAGATGACTTCTGAATGCATGG - Intergenic
950611200 3:14127753-14127775 CAAGACGACTTCTGGATTCATGG + Intronic
951042831 3:18006689-18006711 GTTGATGACTACTGATTGCAGGG + Intronic
953613002 3:44463371-44463393 TAAGATAACTTCTGGTAGCCTGG + Intronic
956326503 3:68058870-68058892 AAAGATGAGCTCTGGTGGCAAGG + Intronic
956880357 3:73504704-73504726 GAAAGTGGCTTGTGGTTGCAGGG - Intronic
957388040 3:79522451-79522473 GATGATTACTTCTGCTTTCAAGG - Intronic
958665168 3:97127977-97127999 AAAGATGACTACTGGGTACAGGG - Intronic
959566876 3:107841306-107841328 GAAAATGACTGGTGTTTGCAGGG - Intergenic
960386736 3:117029606-117029628 TAAGATAACTTCTGGTAGCCTGG + Intronic
961994127 3:131223085-131223107 GAGGCTGACTTCAGGGTGCAAGG + Intronic
962049082 3:131794093-131794115 AGAGATGACTCCTGTTTGCATGG - Intronic
963174467 3:142283481-142283503 TAAGATAACTTCTGGTAGCCTGG + Intergenic
963644207 3:147893435-147893457 CAACATGACTTTTGGTTACAAGG - Intergenic
964475375 3:157092996-157093018 AAAGATGCCATCTGGATGCATGG - Intergenic
964887497 3:161501787-161501809 AAAGATGAATTCTGTTTGAAGGG + Intronic
964961788 3:162436739-162436761 TAAGATAACTTCTGGTAGCATGG - Intergenic
967113683 3:186317933-186317955 GAAAATGACATCAGGATGCAGGG - Intronic
969177576 4:5410554-5410576 GAAGAGGACGTCTGCTTGTAGGG - Intronic
969640963 4:8398409-8398431 GAAGAAGGCTTTTGGTTGAAGGG - Intronic
970205524 4:13651889-13651911 AAAGAGGAATTCTGGGTGCAAGG - Intergenic
971359798 4:25926633-25926655 GAAGCTGACTTTTGGTGGCAAGG - Intronic
971968852 4:33595702-33595724 TAAGATAACTTCTGGTAGCCTGG + Intergenic
972215997 4:36897404-36897426 TAAGATAACTTCTGATAGCATGG + Intergenic
976506667 4:85855000-85855022 GTAGATGACTTCTGGTCACCTGG - Intronic
976643585 4:87364202-87364224 GTAGATAACTTCTGGTAGCTTGG + Intronic
978019500 4:103789616-103789638 TAAGATAACTTCTGGTAGCATGG + Intergenic
978641942 4:110881274-110881296 GAAAATGACATCTGGGTTCAAGG - Intergenic
980706946 4:136510538-136510560 CAAAATGACTTCTGGATCCATGG + Intergenic
980987874 4:139713417-139713439 TAAGATAACTTCTGGTAGCCTGG - Intronic
982710830 4:158757248-158757270 GAAGTTGCCTTCTCCTTGCATGG + Intergenic
984577874 4:181472549-181472571 GGAGGTGACTTCTGGATGCTGGG + Intergenic
984577890 4:181472622-181472644 GGAGGTGACTTCTGGATGCTGGG + Intergenic
984650490 4:182265007-182265029 TAAGATAACTTCTGGTAGCCTGG + Intronic
984997234 4:185446796-185446818 GAAGTTATCTTCTGGTTTCATGG + Intronic
986775519 5:11010530-11010552 GAACATGACTTCAGTTTGCAGGG + Intronic
991341703 5:65618212-65618234 GAAGATGTCTTTTCTTTGCAAGG - Exonic
993422456 5:87719237-87719259 TAAGATAACTTCTGGTAGCCTGG - Intergenic
993760083 5:91784221-91784243 GAAAATGTCTTCTGTTTCCAAGG + Intergenic
994244613 5:97465951-97465973 CAAGATGACTTCTGCTGGCCTGG - Intergenic
994273165 5:97806261-97806283 TAAGATAACTTCTGGTAGCCTGG - Intergenic
994367461 5:98931720-98931742 GAAGATGACTTAGGATTTCATGG - Intergenic
994489243 5:100420342-100420364 TAATATGACTTCTGGTGGCCTGG + Intergenic
994891892 5:105647167-105647189 GAAAATGACTTCCGAATGCAGGG + Intergenic
995635989 5:114191465-114191487 CAAGCTTCCTTCTGGTTGCAAGG - Intergenic
995718935 5:115109155-115109177 GAAGATGACTTCTGATCACCAGG + Intergenic
996534705 5:124565687-124565709 GAGGATAACTTCTGGTTTCAGGG - Intergenic
997818058 5:137036917-137036939 GGAAATGACTTCTGGTTGGGGGG - Intronic
997993825 5:138569650-138569672 GAATATGAATTCTGTATGCATGG - Intronic
999988955 5:157031991-157032013 GAAGATAATTCCTGGCTGCAGGG - Intronic
1004834921 6:19520038-19520060 TATGATGACTTTTGGTTGCAAGG - Intergenic
1005001770 6:21248823-21248845 GAAGATGAGTGGTGGGTGCATGG - Intergenic
1005181491 6:23112430-23112452 TAAGATAACTTCTGGTAGCCTGG - Intergenic
1006412735 6:33884668-33884690 GAAGACCACTTCTGGTTACTAGG - Intergenic
1007438838 6:41839948-41839970 GAACATGATTTTTGGTTACATGG - Intronic
1008142871 6:47852242-47852264 GAAAATGACTTCTGGTATCTAGG + Intergenic
1008448220 6:51618550-51618572 GAAGTTGCCTTGTGGTTGGAAGG + Exonic
1008727173 6:54436106-54436128 GTAGATCACTTCGGGTTGTATGG + Intergenic
1010396724 6:75401280-75401302 GAAGATGTTTCATGGTTGCAAGG - Intronic
1010662988 6:78592879-78592901 AAACATTATTTCTGGTTGCAAGG - Intergenic
1011184251 6:84656859-84656881 GAAGATGCCTGTTGGTTTCATGG + Intergenic
1014042071 6:116839686-116839708 GAAGATCTCTTCTAGTTCCATGG - Intergenic
1014643089 6:123938368-123938390 GCAAATGAGTTCTGGTTTCACGG - Intronic
1016742098 6:147539645-147539667 TAAGATAACTTCTGGTAGCCTGG - Intronic
1020264728 7:6552790-6552812 GAGGATGACTTCAGCTTGGAAGG - Intergenic
1020350552 7:7214306-7214328 TAAGATAACTTCTGGTAGCATGG - Intronic
1021571097 7:22065971-22065993 AAAGATGACAACTGCTTGCAGGG + Intergenic
1022601322 7:31762924-31762946 GAAAACAACTTCAGGTTGCATGG - Intronic
1024438211 7:49383705-49383727 TAAGGTGATTTCTGGGTGCAGGG + Intergenic
1025175857 7:56802135-56802157 GAGGATGACTTGTGCCTGCAGGG + Intergenic
1025695936 7:63774287-63774309 GAGGATGACTTGTGCCTGCAGGG - Intergenic
1027759001 7:82253499-82253521 GAAGATGGTTTCAGGTTACAAGG + Intronic
1028776194 7:94679997-94680019 GAAGCTGAGTTCTTGTTACATGG + Intergenic
1034005983 7:147472758-147472780 AAGAATGACTTCTGGTTTCATGG + Intronic
1034620807 7:152455750-152455772 CAAGTTGAATTCTGGTTGCTGGG - Intergenic
1035924462 8:3712215-3712237 GAAGGTGACTTGTGGGTCCAGGG + Intronic
1036501344 8:9317284-9317306 GATGATCACTTCTGGTGTCAAGG - Intergenic
1037315992 8:17600029-17600051 GAAGATGGCTGCAGGGTGCATGG - Intronic
1037950816 8:23017841-23017863 GAGGATCACTTCTGCTTGCTGGG - Exonic
1040526363 8:48228738-48228760 TAAGATAACTTCTGGTAGCATGG + Intergenic
1040978400 8:53219386-53219408 CAAGATGACAGCTGGTTCCAAGG + Intergenic
1042032401 8:64490705-64490727 GAAGATGCCGTCTTTTTGCAGGG + Intergenic
1043604080 8:81978311-81978333 GAAGTTGACTTCTGGAAGCTTGG + Intergenic
1044417795 8:91955629-91955651 GAAGGTGAATGCTGGTTACATGG - Intronic
1046045611 8:108960804-108960826 AAAGAGGCCTTCTGGTTTCATGG + Intergenic
1047281361 8:123448930-123448952 GAAGATGACATCTGGCTGAGAGG + Intronic
1047727326 8:127695176-127695198 GAAGATGACTTCTAGCTGAGAGG - Intergenic
1048310961 8:133322304-133322326 GAAGATTACCTCTGTTTTCAGGG + Intergenic
1050351754 9:4746452-4746474 GATGATGACTTAAGCTTGCATGG + Intergenic
1051219572 9:14833868-14833890 TAAGATAACTTCTGGTAGCATGG + Intronic
1053231996 9:36418116-36418138 GAAGATTACTTGAGGTTGCATGG - Intronic
1056048843 9:82746865-82746887 GAATATGACTGCTGGATGCTGGG - Intergenic
1056372245 9:85968207-85968229 GAAGATAACTGCTGGTCACATGG - Intronic
1058031644 9:100205362-100205384 TAAGATGTCTTCTACTTGCAAGG + Intronic
1061098374 9:128473218-128473240 GAAGATGACCTCTGGTCACCAGG + Intronic
1061724187 9:132572521-132572543 CAAGATGGCTTCTTGTGGCAGGG - Exonic
1186851549 X:13584924-13584946 GAAGATAGATTCTGGTTGCTTGG - Intronic
1188687057 X:33082023-33082045 TAAGATAACTTCTGGTAGCCTGG - Intronic
1188798142 X:34491829-34491851 AAAGATGCCTTCTGGGTGTAAGG - Intergenic
1190722891 X:53165203-53165225 TGAGATAACTTCTGGTAGCATGG + Intergenic
1193791096 X:85815851-85815873 TAAGATAACTTCTGGTAGCCTGG + Intergenic
1195291693 X:103436048-103436070 GCAGATGAAATCTGGGTGCAGGG - Intergenic
1197444075 X:126527023-126527045 CAAAATGACTTCTGGATCCATGG + Intergenic
1197746984 X:129938219-129938241 GAAGAGGAGTCCGGGTTGCAAGG - Intergenic
1198385684 X:136127456-136127478 GAGGATGAATTCTGGTTTCCGGG - Intergenic
1198931926 X:141871409-141871431 TAAAATGACTTCTGGTGGCCTGG - Intronic
1199303178 X:146236478-146236500 GAATATGACTTCTAATTGCAAGG + Intergenic
1201636609 Y:16129320-16129342 TAAAATGACTTCTGGTGGCCTGG + Intergenic
1201749320 Y:17415227-17415249 TAAGATAACTTCTGGTAGCCTGG + Intergenic