ID: 1070499905

View in Genome Browser
Species Human (GRCh38)
Location 10:77062948-77062970
Sequence GGAAATCGGAAGATGACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070499905_1070499910 2 Left 1070499905 10:77062948-77062970 CCAGAAGTCATCTTCCGATTTCC No data
Right 1070499910 10:77062973-77062995 CTCCCAAAGAGCTATGGTGATGG No data
1070499905_1070499907 -4 Left 1070499905 10:77062948-77062970 CCAGAAGTCATCTTCCGATTTCC No data
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data
1070499905_1070499911 3 Left 1070499905 10:77062948-77062970 CCAGAAGTCATCTTCCGATTTCC No data
Right 1070499911 10:77062974-77062996 TCCCAAAGAGCTATGGTGATGGG No data
1070499905_1070499914 11 Left 1070499905 10:77062948-77062970 CCAGAAGTCATCTTCCGATTTCC No data
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070499905 Original CRISPR GGAAATCGGAAGATGACTTC TGG (reversed) Intronic
No off target data available for this crispr