ID: 1070499906

View in Genome Browser
Species Human (GRCh38)
Location 10:77062962-77062984
Sequence GCTCTTTGGGAGGAGGAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14732
Summary {0: 1, 1: 0, 2: 19, 3: 674, 4: 14038}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070499906_1070499914 -3 Left 1070499906 10:77062962-77062984 CCGATTTCCTCCTCCCAAAGAGC 0: 1
1: 0
2: 19
3: 674
4: 14038
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data
1070499906_1070499916 23 Left 1070499906 10:77062962-77062984 CCGATTTCCTCCTCCCAAAGAGC 0: 1
1: 0
2: 19
3: 674
4: 14038
Right 1070499916 10:77063008-77063030 ACTATTCTACAACTGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070499906 Original CRISPR GCTCTTTGGGAGGAGGAAAT CGG (reversed) Intronic
Too many off-targets to display for this crispr