ID: 1070499907

View in Genome Browser
Species Human (GRCh38)
Location 10:77062967-77062989
Sequence TTCCTCCTCCCAAAGAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070499905_1070499907 -4 Left 1070499905 10:77062948-77062970 CCAGAAGTCATCTTCCGATTTCC No data
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data
1070499902_1070499907 12 Left 1070499902 10:77062932-77062954 CCAACCAGCCATGCAACCAGAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data
1070499904_1070499907 4 Left 1070499904 10:77062940-77062962 CCATGCAACCAGAAGTCATCTTC 0: 1
1: 0
2: 1
3: 25
4: 216
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data
1070499899_1070499907 19 Left 1070499899 10:77062925-77062947 CCATTCCCCAACCAGCCATGCAA 0: 1
1: 0
2: 2
3: 33
4: 263
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data
1070499898_1070499907 29 Left 1070499898 10:77062915-77062937 CCTAGCTCTACCATTCCCCAACC 0: 1
1: 0
2: 4
3: 38
4: 367
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data
1070499900_1070499907 14 Left 1070499900 10:77062930-77062952 CCCCAACCAGCCATGCAACCAGA 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data
1070499901_1070499907 13 Left 1070499901 10:77062931-77062953 CCCAACCAGCCATGCAACCAGAA 0: 1
1: 0
2: 1
3: 24
4: 167
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data
1070499897_1070499907 30 Left 1070499897 10:77062914-77062936 CCCTAGCTCTACCATTCCCCAAC 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data
1070499903_1070499907 8 Left 1070499903 10:77062936-77062958 CCAGCCATGCAACCAGAAGTCAT 0: 1
1: 0
2: 0
3: 14
4: 125
Right 1070499907 10:77062967-77062989 TTCCTCCTCCCAAAGAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070499907 Original CRISPR TTCCTCCTCCCAAAGAGCTA TGG Intronic
No off target data available for this crispr