ID: 1070499908

View in Genome Browser
Species Human (GRCh38)
Location 10:77062969-77062991
Sequence CACCATAGCTCTTTGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 776
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 745}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070499908_1070499916 16 Left 1070499908 10:77062969-77062991 CCTCCTCCCAAAGAGCTATGGTG 0: 1
1: 0
2: 0
3: 30
4: 745
Right 1070499916 10:77063008-77063030 ACTATTCTACAACTGAAGAAAGG No data
1070499908_1070499917 30 Left 1070499908 10:77062969-77062991 CCTCCTCCCAAAGAGCTATGGTG 0: 1
1: 0
2: 0
3: 30
4: 745
Right 1070499917 10:77063022-77063044 GAAGAAAGGTCAGAGACATTAGG No data
1070499908_1070499914 -10 Left 1070499908 10:77062969-77062991 CCTCCTCCCAAAGAGCTATGGTG 0: 1
1: 0
2: 0
3: 30
4: 745
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070499908 Original CRISPR CACCATAGCTCTTTGGGAGG AGG (reversed) Intronic
900908072 1:5574921-5574943 CAAAAAAGCTCTTGGGGAGGGGG - Intergenic
901067701 1:6502277-6502299 CCCCATGGCGCTTTGGGAAGGGG - Intronic
901158892 1:7159991-7160013 AATCCTAGCACTTTGGGAGGAGG + Intronic
901284833 1:8069297-8069319 AATCCTAGCACTTTGGGAGGTGG - Intergenic
901553831 1:10016176-10016198 CACCAGAGCTCTGGGGGTGGGGG + Intergenic
901764876 1:11493469-11493491 AATCCTAGCACTTTGGGAGGCGG + Intronic
901841019 1:11954214-11954236 CATCCCAGCACTTTGGGAGGCGG + Intronic
902357773 1:15918470-15918492 AATCCTAGCACTTTGGGAGGTGG - Intronic
902520870 1:17015341-17015363 AATCCTAGCGCTTTGGGAGGTGG - Intergenic
903099903 1:21020232-21020254 AATCTTAGCACTTTGGGAGGCGG + Intronic
903768669 1:25750459-25750481 CTCCATGGCTCCTTGGGTGGCGG - Intronic
903841182 1:26242013-26242035 AATCCTAGCACTTTGGGAGGCGG - Intronic
904025814 1:27503018-27503040 AATCACAGCACTTTGGGAGGCGG - Intergenic
904051615 1:27643015-27643037 AATCCTAGCACTTTGGGAGGTGG + Intergenic
904234681 1:29107597-29107619 AATCTCAGCTCTTTGGGAGGTGG + Intronic
905184871 1:36188967-36188989 AATCCTAGCACTTTGGGAGGCGG - Intergenic
905555785 1:38883016-38883038 AATCCTAGCACTTTGGGAGGAGG + Intergenic
906500473 1:46338422-46338444 AATCACAGCACTTTGGGAGGTGG + Intergenic
906772183 1:48494975-48494997 AATCCCAGCTCTTTGGGAGGGGG + Intergenic
906981669 1:50637591-50637613 ATCCATAGCTGTCTGGGAGGAGG + Intronic
907281223 1:53348666-53348688 GCCCAGAGCTCTTTGGGAGTGGG + Intergenic
907750545 1:57258884-57258906 CTCCCCAGCTCTTGGGGAGGTGG - Intronic
908554488 1:65243925-65243947 CACCAAAGCTGTTAGGGAGAAGG + Intergenic
909639032 1:77851122-77851144 AATCCTAGCACTTTGGGAGGCGG - Intronic
909650483 1:77970789-77970811 AATCTTAGCACTTTGGGAGGTGG + Intronic
909652780 1:77994146-77994168 AATCCTAGCACTTTGGGAGGCGG + Intronic
909742392 1:79046013-79046035 CACCACAGCTTTTTAGGGGGAGG + Intergenic
909950203 1:81710369-81710391 AATCACAGCACTTTGGGAGGCGG + Intronic
909965486 1:81904654-81904676 AACCACAGCACTTTGGGAAGCGG + Intronic
910232206 1:84997877-84997899 AATCCTAGCACTTTGGGAGGCGG - Intergenic
911003237 1:93189912-93189934 CATCCCAGCACTTTGGGAGGTGG - Intronic
911931024 1:103903679-103903701 AATCCTAGCACTTTGGGAGGTGG - Intergenic
912766117 1:112412870-112412892 CATCCCAGCACTTTGGGAGGTGG - Intronic
912998973 1:114560684-114560706 AATCCTAGCACTTTGGGAGGTGG - Intergenic
914097187 1:144554037-144554059 AATCCTAGCACTTTGGGAGGCGG - Intergenic
914842639 1:151261098-151261120 CATCCCAGCACTTTGGGAGGTGG - Intronic
915434719 1:155895541-155895563 AATCCTAGCACTTTGGGAGGTGG - Intergenic
915623581 1:157100676-157100698 AATCCTAGCACTTTGGGAGGCGG - Intergenic
915960622 1:160263368-160263390 AATCCTAGCACTTTGGGAGGCGG + Intergenic
916396901 1:164400819-164400841 AATCCTAGCACTTTGGGAGGCGG + Intergenic
917050248 1:170914608-170914630 AACCCCAGCACTTTGGGAGGCGG - Intergenic
917060009 1:171027210-171027232 CACCAGAGCCTGTTGGGAGGTGG - Intronic
917520767 1:175746954-175746976 CACCATTCCTCTTTGGAAGCTGG + Intergenic
917674228 1:177304074-177304096 CACAATAGCTTTCTGGGAGAAGG - Intergenic
917855007 1:179092597-179092619 CATCCTAGCACTTTGGGAGGCGG + Intronic
917908323 1:179612679-179612701 AATCCTAGCACTTTGGGAGGCGG + Intronic
917956976 1:180109369-180109391 AATCCTAGCACTTTGGGAGGCGG - Intronic
918309347 1:183274676-183274698 AATCCTAGCACTTTGGGAGGCGG + Intronic
918459432 1:184760679-184760701 AATCCTAGCACTTTGGGAGGCGG - Intergenic
918660633 1:187083303-187083325 AATCCCAGCTCTTTGGGAGGCGG - Intergenic
919447091 1:197720492-197720514 AATCCTAGCACTTTGGGAGGCGG - Intronic
919906228 1:202080273-202080295 AATCCTAGCACTTTGGGAGGTGG + Intergenic
919952139 1:202374795-202374817 AATCCTAGCACTTTGGGAGGCGG - Intronic
920484421 1:206355711-206355733 AACCCCAGCACTTTGGGAGGCGG + Intronic
920916118 1:210259431-210259453 AATCCTAGCACTTTGGGAGGCGG - Intergenic
921691131 1:218152095-218152117 CAGCATATCCCTTTAGGAGGTGG + Intergenic
921947637 1:220896958-220896980 AATCCTAGCACTTTGGGAGGCGG + Intergenic
922444465 1:225684848-225684870 CATCCCAGCACTTTGGGAGGTGG - Intergenic
923130125 1:231067801-231067823 AATCCTAGCACTTTGGGAGGTGG - Intergenic
923697994 1:236273569-236273591 AATCTTAGCACTTTGGGAGGCGG + Intronic
923883641 1:238131187-238131209 AATCCTAGCTTTTTGGGAGGTGG - Intergenic
923979632 1:239307544-239307566 AATCTTAGCACTTTGGGAGGCGG + Intergenic
924798972 1:247313269-247313291 GACCATAGCACTAGGGGAGGGGG + Intronic
1062898704 10:1125461-1125483 AATCCTAGCACTTTGGGAGGCGG - Intronic
1062993288 10:1840886-1840908 AACCCCAGCACTTTGGGAGGTGG + Intergenic
1063265607 10:4446637-4446659 CACCAGAGCCTGTTGGGAGGTGG + Intergenic
1063354141 10:5382264-5382286 CATCCCAGCACTTTGGGAGGTGG - Intergenic
1063887788 10:10596934-10596956 CACCATAGCTTTCTGGGTGGAGG - Intergenic
1064053307 10:12076907-12076929 AATCCTAGCACTTTGGGAGGCGG - Intronic
1065402188 10:25317974-25317996 AATCCTAGCACTTTGGGAGGCGG - Intronic
1065446744 10:25810069-25810091 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1065494545 10:26315169-26315191 AACCCCAGCACTTTGGGAGGCGG - Intergenic
1066360508 10:34726200-34726222 AACCCCAGCACTTTGGGAGGTGG + Intronic
1066476568 10:35752706-35752728 GTCCACAGCTCTTTGGAAGGGGG - Intergenic
1066496211 10:35944738-35944760 AATCCTAGCACTTTGGGAGGTGG + Intergenic
1066689157 10:38009613-38009635 AACCCCAGCACTTTGGGAGGCGG - Intergenic
1067371885 10:45691733-45691755 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1067387897 10:45834420-45834442 AATCCTAGCACTTTGGGAGGTGG + Intronic
1067408072 10:46041088-46041110 AATCCTAGCACTTTGGGAGGCGG + Intronic
1067413885 10:46089391-46089413 AATCACAGCACTTTGGGAGGCGG - Intergenic
1067418226 10:46122844-46122866 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1067446372 10:46350192-46350214 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1067503583 10:46829428-46829450 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1067591008 10:47510575-47510597 AATCCTAGCACTTTGGGAGGTGG + Intronic
1067638126 10:48018672-48018694 AATCCTAGCACTTTGGGAGGTGG + Intergenic
1067875367 10:50001670-50001692 AATCCTAGCACTTTGGGAGGTGG - Intronic
1068096050 10:52492917-52492939 CATCCCAGCACTTTGGGAGGCGG - Intergenic
1069468496 10:68664084-68664106 TATCCTAGCACTTTGGGAGGTGG - Intronic
1069672411 10:70219154-70219176 AATCCTAGCACTTTGGGAGGTGG - Intronic
1069754800 10:70767338-70767360 AATCCTAGCGCTTTGGGAGGTGG + Intergenic
1069961645 10:72082598-72082620 AATCCTAGCACTTTGGGAGGCGG + Intronic
1070111176 10:73488032-73488054 AACCCCAGCACTTTGGGAGGTGG - Intronic
1070124916 10:73613389-73613411 AACCCCAGCACTTTGGGAGGGGG - Intronic
1070134729 10:73683098-73683120 AATCCTAGCACTTTGGGAGGTGG + Intronic
1070239789 10:74667784-74667806 AATCCTAGCACTTTGGGAGGTGG - Intronic
1070271728 10:74963038-74963060 CACAATAGCTCTGTGGATGGAGG - Intronic
1070298421 10:75184810-75184832 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1070332674 10:75429662-75429684 CAGGATAGCTCTGTTGGAGGGGG - Intergenic
1070499908 10:77062969-77062991 CACCATAGCTCTTTGGGAGGAGG - Intronic
1070620561 10:78006863-78006885 AATCCTAGCACTTTGGGAGGTGG + Intronic
1070942327 10:80358122-80358144 AATCCTAGCACTTTGGGAGGCGG + Intronic
1071607010 10:87001310-87001332 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1072046008 10:91655859-91655881 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1072291420 10:93969123-93969145 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1072890263 10:99317037-99317059 AATCTCAGCTCTTTGGGAGGCGG - Intergenic
1073293512 10:102424928-102424950 AACCATAGCTCTGAGGGAGGGGG - Intronic
1073399235 10:103243195-103243217 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1073747502 10:106486219-106486241 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1073790932 10:106939705-106939727 CACCATTTCCCTTTGGAAGGAGG + Intronic
1074121175 10:110495626-110495648 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1074476475 10:113779315-113779337 AACCCCAGCACTTTGGGAGGCGG + Intronic
1075036791 10:119076083-119076105 AATCACAGCACTTTGGGAGGCGG + Intronic
1075330652 10:121571558-121571580 AATCCTAGCACTTTGGGAGGCGG - Intronic
1075510424 10:123067758-123067780 CAACATAGGGATTTGGGAGGAGG + Intergenic
1075879756 10:125840645-125840667 CACCAGAGCTCCGTGGGAGCAGG + Intronic
1076550555 10:131275141-131275163 CTCCTTAGCTCTGTGGGAGGAGG - Intronic
1076568429 10:131414552-131414574 CACAATAGTGTTTTGGGAGGAGG + Intergenic
1076776224 10:132699611-132699633 CCCCATAGCTCTTGGGGGTGGGG + Intronic
1077055079 11:587625-587647 CACCATGGCTCTTGGGGGTGTGG + Intronic
1077824028 11:5784507-5784529 AACCCCAGCACTTTGGGAGGCGG + Intronic
1077944021 11:6875334-6875356 AATCACAGCTCTTTGGGAGGTGG - Intergenic
1078341290 11:10499467-10499489 AATCCTAGCACTTTGGGAGGAGG - Intronic
1078774815 11:14384184-14384206 GATCCCAGCTCTTTGGGAGGTGG + Intergenic
1078965321 11:16333187-16333209 CAGCATATTACTTTGGGAGGAGG - Intronic
1079079585 11:17405016-17405038 AACCCCAGCACTTTGGGAGGCGG - Intronic
1079740689 11:24055911-24055933 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1080702646 11:34657406-34657428 CAACACTGCTCTTTGGGAGTTGG + Intronic
1080870457 11:36232479-36232501 CACTATAGCTCTTGGATAGGTGG + Intergenic
1081127764 11:39341607-39341629 CATCATAGCTCCCTGGGAGAAGG - Intergenic
1081203655 11:40249082-40249104 CATCTCAGCACTTTGGGAGGCGG + Intronic
1081300786 11:41448557-41448579 AATCACAGCACTTTGGGAGGCGG - Intronic
1082062310 11:47871421-47871443 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1082812316 11:57485886-57485908 CATCACAATTCTTTGGGAGGAGG + Intronic
1083086048 11:60146695-60146717 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1083115961 11:60459990-60460012 TATCCTAGCACTTTGGGAGGTGG + Intronic
1083361089 11:62108674-62108696 AACCCCAGCACTTTGGGAGGCGG + Intergenic
1083536617 11:63473950-63473972 AATCCTAGCCCTTTGGGAGGTGG - Intronic
1083600113 11:63941805-63941827 AACCCCAGCACTTTGGGAGGCGG - Intronic
1083906310 11:65673753-65673775 AATCTCAGCTCTTTGGGAGGAGG - Intergenic
1083953458 11:65969666-65969688 AACCCCAGCACTTTGGGAGGTGG - Intronic
1084278196 11:68067347-68067369 AATCACAGCACTTTGGGAGGTGG + Intronic
1084409014 11:68995444-68995466 AACCCCAGCACTTTGGGAGGTGG - Intergenic
1084469015 11:69344356-69344378 CAACATACACCTTTGGGAGGGGG - Intronic
1084645118 11:70452179-70452201 AATCGTAGCACTTTGGGAGGCGG - Intergenic
1084684146 11:70684035-70684057 CATCTCAGCACTTTGGGAGGTGG - Intronic
1085282994 11:75342836-75342858 AACCAGAGCTCTCTGGGAAGGGG - Intronic
1085684617 11:78610375-78610397 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1086115704 11:83247320-83247342 AACCCCAGCACTTTGGGAGGCGG - Intronic
1086577836 11:88361043-88361065 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1086908003 11:92439660-92439682 GATCTCAGCTCTTTGGGAGGTGG + Intronic
1087921607 11:103872980-103873002 AATCTTAGCACTTTGGGAGGTGG + Intergenic
1088328207 11:108623760-108623782 CATCTCAGCACTTTGGGAGGTGG - Intergenic
1089503483 11:118947142-118947164 CCTCATAGGTCTTTGGCAGGAGG + Intronic
1090078653 11:123595545-123595567 AATCACAGCACTTTGGGAGGCGG - Intronic
1090340301 11:126012660-126012682 AATCCTAGCACTTTGGGAGGTGG - Intronic
1090833179 11:130434063-130434085 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1091241297 11:134054124-134054146 CATCCCAGCACTTTGGGAGGCGG + Intergenic
1092570613 12:9717155-9717177 AATCCTAGCGCTTTGGGAGGCGG + Intronic
1092611934 12:10181771-10181793 CCCAACAGCACTTTGGGAGGCGG + Intronic
1092709850 12:11324455-11324477 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1094081299 12:26538826-26538848 AATCCTAGCACTTTGGGAGGTGG - Intronic
1094464474 12:30737245-30737267 AACCCTAGCCCTTTGGGAGGAGG - Intronic
1094482963 12:30899499-30899521 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1094556153 12:31502061-31502083 AATCCTAGCACTTTGGGAGGCGG + Intronic
1094556286 12:31503304-31503326 AATCCTAGCACTTTGGGAGGTGG + Intronic
1095531343 12:43190156-43190178 AATCCTAGCACTTTGGGAGGAGG - Intergenic
1096068133 12:48757392-48757414 AATCCTAGCCCTTTGGGAGGCGG + Intergenic
1096132366 12:49169958-49169980 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1096254048 12:50052140-50052162 ATCCAAAGCACTTTGGGAGGCGG - Intergenic
1096339941 12:50789508-50789530 AATCCTAGCACTTTGGGAGGCGG + Intronic
1096340171 12:50791300-50791322 AATCCTAGCACTTTGGGAGGCGG + Intronic
1096459741 12:51815450-51815472 CATCACAGCACTTTGGGAGGTGG - Intergenic
1096837724 12:54361759-54361781 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1097093457 12:56526051-56526073 AATCCCAGCTCTTTGGGAGGTGG + Intronic
1097668268 12:62506476-62506498 AATCACAGCGCTTTGGGAGGAGG + Intronic
1097929435 12:65168223-65168245 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1099013545 12:77319993-77320015 AATCCCAGCTCTTTGGGAGGTGG - Intergenic
1099390703 12:82075208-82075230 AACCCTAGCACTTTGGGAGGTGG + Intergenic
1100256841 12:92892343-92892365 AACCCCAGCACTTTGGGAGGCGG - Intronic
1100300238 12:93300290-93300312 AATCCTAGCACTTTGGGAGGTGG + Intergenic
1100309599 12:93382001-93382023 CATCCCAGCACTTTGGGAGGCGG + Intronic
1101094553 12:101323883-101323905 AATCCCAGCTCTTTGGGAGGCGG + Intronic
1101350552 12:103926681-103926703 CATCCCAGCACTTTGGGAGGCGG + Intergenic
1101646524 12:106635564-106635586 AATCCTAGCACTTTGGGAGGCGG - Intronic
1101656414 12:106724766-106724788 AATCCTAGCACTTTGGGAGGTGG + Intronic
1102127591 12:110497468-110497490 AATCCTAGCACTTTGGGAGGCGG - Intronic
1102374844 12:112413770-112413792 AATCCTAGCACTTTGGGAGGCGG + Intronic
1102487925 12:113270730-113270752 AATCACAGCACTTTGGGAGGCGG - Intronic
1102996075 12:117351554-117351576 CTCCATTGCCCCTTGGGAGGAGG + Intronic
1103042771 12:117709569-117709591 TATCCTAGCACTTTGGGAGGTGG - Intronic
1103266447 12:119634492-119634514 CATCCTAGCTATTTGGGAGGCGG + Intronic
1103298725 12:119910411-119910433 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1103452489 12:121039074-121039096 CTCCAGTGCTCTGTGGGAGGAGG + Exonic
1104043723 12:125146842-125146864 AATCCTAGCACTTTGGGAGGAGG + Intergenic
1105501649 13:20978166-20978188 CATCCCAGCACTTTGGGAGGCGG - Intronic
1105791321 13:23802319-23802341 AATCCTAGCACTTTGGGAGGTGG + Intronic
1105994179 13:25654458-25654480 AATCCTAGCACTTTGGGAGGAGG - Intronic
1106085149 13:26535169-26535191 CATCCAAGCACTTTGGGAGGTGG + Intergenic
1106234045 13:27846414-27846436 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1106268878 13:28135260-28135282 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1106524787 13:30530791-30530813 AATCCTAGCACTTTGGGAGGTGG + Intronic
1106539251 13:30675140-30675162 CATCCCAGCACTTTGGGAGGCGG - Intergenic
1106846912 13:33746605-33746627 AACCCCAGCACTTTGGGAGGTGG + Intergenic
1108159101 13:47619191-47619213 CTCCATGGCTGTTTGGGAAGCGG - Intergenic
1108575405 13:51786171-51786193 TGCCTTAGCTCTTTGGCAGGAGG - Intronic
1109060846 13:57618380-57618402 AACCTCAGCACTTTGGGAGGCGG - Intergenic
1109672629 13:65629346-65629368 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1109787968 13:67206409-67206431 AATCCCAGCTCTTTGGGAGGCGG - Intronic
1110093472 13:71484812-71484834 AACCCCAGCACTTTGGGAGGTGG + Intronic
1110220632 13:73068840-73068862 AATCCCAGCTCTTTGGGAGGCGG + Intronic
1110373807 13:74769135-74769157 AATCACAGCACTTTGGGAGGTGG + Intergenic
1110578389 13:77088035-77088057 AATCCTAGCACTTTGGGAGGCGG - Intronic
1110885164 13:80623759-80623781 AATCCCAGCTCTTTGGGAGGCGG + Intergenic
1111073839 13:83205964-83205986 AACCCCAGCACTTTGGGAGGCGG - Intergenic
1111771453 13:92601300-92601322 AATCCTAGCACTTTGGGAGGCGG + Intronic
1111958140 13:94780571-94780593 AATCCTAGCACTTTGGGAGGAGG - Intergenic
1112058380 13:95712623-95712645 AATCCCAGCTCTTTGGGAGGCGG - Intronic
1112271344 13:97973293-97973315 AATCCTAGCACTTTGGGAGGCGG - Intronic
1112283117 13:98080064-98080086 GATCCTAGCACTTTGGGAGGCGG - Intergenic
1112296134 13:98188697-98188719 CACTATGGCTCTAAGGGAGGTGG + Intronic
1112465107 13:99637125-99637147 AACCCCAGCACTTTGGGAGGCGG - Intronic
1112531452 13:100207764-100207786 AATCCTAGCACTTTGGGAGGCGG + Intronic
1114498138 14:23148097-23148119 CAGCATATCTCTTTGGGATGGGG + Intronic
1115120624 14:29932587-29932609 AATCCTAGCACTTTGGGAGGCGG + Intronic
1117011064 14:51471234-51471256 AATCCTAGCACTTTGGGAGGTGG + Intergenic
1117343937 14:54814769-54814791 CTCCACAGCTCTTTGAGAGCTGG - Intergenic
1117544897 14:56785091-56785113 TTCCATAGCTCTTTCGGAGAGGG - Intergenic
1117651241 14:57907948-57907970 CACCAGGGCTTGTTGGGAGGTGG - Intronic
1117683003 14:58224563-58224585 AACCCCAGCACTTTGGGAGGTGG + Intronic
1117683145 14:58226028-58226050 AACCCCAGCACTTTGGGAGGTGG + Intronic
1117815478 14:59593272-59593294 AATCCTAGCACTTTGGGAGGAGG + Intergenic
1117830398 14:59744257-59744279 TACCAAAGCTCTTTGGGATATGG + Intronic
1117936874 14:60916696-60916718 AATCCTAGCACTTTGGGAGGCGG + Intronic
1118783765 14:69028413-69028435 AACCCCAGCACTTTGGGAGGCGG + Intergenic
1118913202 14:70079228-70079250 AACCACAGCACTTTGGGATGTGG + Intronic
1119057730 14:71440278-71440300 AATCCTAGCACTTTGGGAGGTGG - Intronic
1119958790 14:78831292-78831314 AACCCCAGCACTTTGGGAGGTGG + Intronic
1120848924 14:89151091-89151113 AATCAAAGCACTTTGGGAGGTGG + Intronic
1120856567 14:89217628-89217650 CACCCTAGTTCATAGGGAGGTGG + Intronic
1121353803 14:93196189-93196211 AATCCTAGCACTTTGGGAGGGGG - Intronic
1121716424 14:96079214-96079236 CGCCATAGCACCTTAGGAGGTGG + Intronic
1121757117 14:96412479-96412501 AACCCCAGCACTTTGGGAGGCGG - Intronic
1122449727 14:101796074-101796096 AATCCTAGCACTTTGGGAGGCGG - Intronic
1122451443 14:101811594-101811616 AATCTTAGCACTTTGGGAGGCGG - Intronic
1122655483 14:103256415-103256437 AACCCCAGCACTTTGGGAGGCGG - Intergenic
1122702748 14:103601166-103601188 AACCCCAGCACTTTGGGAGGCGG - Intronic
1123694946 15:22872030-22872052 AATCCTAGCACTTTGGGAGGTGG + Intronic
1124709256 15:31991989-31992011 AACCCCAGCACTTTGGGAGGCGG - Intergenic
1125526881 15:40382165-40382187 AATTATAGCACTTTGGGAGGTGG - Intergenic
1125615167 15:41004939-41004961 AATCCTAGCACTTTGGGAGGTGG + Intronic
1125931374 15:43602435-43602457 AATCACAGCACTTTGGGAGGCGG - Intronic
1126105712 15:45145660-45145682 AATCCTAGCACTTTGGGAGGCGG + Intronic
1126600849 15:50425867-50425889 AATCCTAGCACTTTGGGAGGCGG + Intronic
1126653654 15:50952968-50952990 CATCCCAGCACTTTGGGAGGTGG + Intronic
1126708669 15:51431883-51431905 AATCCTAGCACTTTGGGAGGTGG + Intergenic
1127505611 15:59595268-59595290 AATCCTAGCACTTTGGGAGGTGG + Intronic
1127878851 15:63138070-63138092 AATCACAGCACTTTGGGAGGTGG + Intronic
1128286801 15:66443982-66444004 CATCCCAGCACTTTGGGAGGCGG + Intronic
1128319775 15:66685063-66685085 CACCACACCTCTCAGGGAGGTGG - Intronic
1128367543 15:67015103-67015125 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1128526634 15:68416670-68416692 AATCCTAGCACTTTGGGAGGCGG + Intronic
1128832231 15:70780008-70780030 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1129106558 15:73312764-73312786 AATCCCAGCTCTTTGGGAGGCGG - Intergenic
1129204614 15:74029368-74029390 AATCCTAGCACTTTGGGAGGCGG + Intronic
1130971245 15:88735030-88735052 AATCCTAGCACTTTGGGAGGTGG + Intergenic
1130994431 15:88895974-88895996 AACCCCAGCACTTTGGGAGGTGG + Intergenic
1131913713 15:97238103-97238125 AATCACAGCTATTTGGGAGGCGG + Intergenic
1132285501 15:100659234-100659256 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1133104462 16:3497908-3497930 CACCCCAGCACTTTGGGAGGTGG - Intergenic
1133135477 16:3708232-3708254 AATCACAGCACTTTGGGAGGTGG + Intronic
1133167040 16:3955269-3955291 CATCCCAGCACTTTGGGAGGTGG + Intronic
1133248105 16:4462618-4462640 CATCCCAGCACTTTGGGAGGTGG + Intronic
1133251537 16:4485217-4485239 AATCATAGCACTTTGGGACGTGG - Intronic
1133331171 16:4975217-4975239 AATCCTAGCACTTTGGGAGGCGG + Intronic
1133810580 16:9158294-9158316 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1134647106 16:15877799-15877821 CCTCACAGCACTTTGGGAGGTGG + Intronic
1135142067 16:19930319-19930341 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1135685167 16:24493042-24493064 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1135843163 16:25894757-25894779 AACCCCAGCACTTTGGGAGGCGG - Intronic
1136358701 16:29763632-29763654 CATCCCAGCACTTTGGGAGGCGG + Intergenic
1136464384 16:30432071-30432093 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1136588048 16:31200558-31200580 CACCCCAGCACTTTGGGAGGTGG + Intergenic
1137083925 16:36099349-36099371 CATCTCAGCACTTTGGGAGGCGG - Intergenic
1138114208 16:54347603-54347625 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1138156888 16:54714077-54714099 CTCCTTAGCACTTAGGGAGGGGG - Intergenic
1138642857 16:58399058-58399080 AACCCTAGCACTTTGGGAGGTGG + Intronic
1138695490 16:58808898-58808920 AAACAGAGCTCTTTGGGATGGGG - Intergenic
1138953001 16:61936572-61936594 GAACATGCCTCTTTGGGAGGCGG - Intronic
1139244506 16:65428299-65428321 AACCCTAGCACTTTGGGAGATGG - Intergenic
1139382403 16:66541668-66541690 AATCCTAGCACTTTGGGAGGCGG - Intronic
1139930964 16:70525712-70525734 AATCCTAGCACTTTGGGAGGCGG + Intronic
1140038363 16:71388725-71388747 AATCACAGCACTTTGGGAGGTGG + Intronic
1140871102 16:79107192-79107214 CATCCCAGCACTTTGGGAGGCGG - Intronic
1141059847 16:80856044-80856066 AATCCCAGCTCTTTGGGAGGTGG - Intergenic
1141061998 16:80882283-80882305 AACCCCAGCACTTTGGGAGGCGG + Intergenic
1142247661 16:88977224-88977246 CACCAGAGCTGCCTGGGAGGAGG - Intergenic
1203142703 16_KI270728v1_random:1778884-1778906 CATCCCAGCACTTTGGGAGGTGG + Intergenic
1142630102 17:1220036-1220058 AATCACAGCACTTTGGGAGGCGG + Intronic
1142666154 17:1465063-1465085 AACCCCAGCACTTTGGGAGGCGG - Exonic
1142757963 17:2026589-2026611 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1142771090 17:2097387-2097409 CATCCCAGCACTTTGGGAGGCGG - Intronic
1143341336 17:6213713-6213735 AATCCTAGCACTTTGGGAGGAGG - Intergenic
1143672722 17:8407543-8407565 AATCCTGGCTCTTTGGGAGGCGG + Intergenic
1143746215 17:8996100-8996122 GACCATGGCTCCTTGGGATGAGG - Intergenic
1143867239 17:9932917-9932939 AATCCTAGCACTTTGGGAGGCGG + Intronic
1144163708 17:12586718-12586740 AATCATAGTGCTTTGGGAGGCGG + Intergenic
1146032987 17:29382355-29382377 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1146079606 17:29766239-29766261 AATCCTAGCACTTTGGGAGGCGG + Intronic
1146328188 17:31904931-31904953 CATCCCAGCACTTTGGGAGGTGG - Intergenic
1146826237 17:36025424-36025446 TATCCTAGCACTTTGGGAGGTGG - Intergenic
1147109425 17:38251010-38251032 AATCTTAGCACTTTGGGAGGTGG - Intergenic
1147271610 17:39276415-39276437 AACCCCAGCACTTTGGGAGGCGG + Intronic
1147618150 17:41843251-41843273 AATCCTAGCACTTTGGGAGGCGG + Intronic
1147662788 17:42125891-42125913 CTTCTTAGCTGTTTGGGAGGGGG + Exonic
1147869321 17:43576540-43576562 AATCCTAGCACTTTGGGAGGCGG - Intronic
1148359110 17:46997095-46997117 AATCCTAGCACTTTGGGAGGCGG + Intronic
1148420023 17:47537069-47537091 AATCTTAGCACTTTGGGAGGTGG + Intronic
1148465151 17:47860608-47860630 AACCCCAGCACTTTGGGAGGCGG + Intergenic
1148504262 17:48114918-48114940 AATCCTAGCACTTTGGGAGGTGG - Intronic
1148727500 17:49804520-49804542 AATCCTAGCACTTTGGGAGGCGG + Intronic
1148996457 17:51714478-51714500 CTCTGGAGCTCTTTGGGAGGTGG + Intronic
1149798341 17:59542703-59542725 AATCCCAGCTCTTTGGGAGGCGG + Intergenic
1149832450 17:59884005-59884027 AATCCTAGCACTTTGGGAGGCGG + Intronic
1150659490 17:67063004-67063026 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1150674310 17:67231797-67231819 AATCCTAGCACTTTGGGAGGCGG + Intronic
1150924914 17:69522800-69522822 AATCACAGCCCTTTGGGAGGTGG + Intronic
1151729101 17:75900470-75900492 AATCCTAGCACTTTGGGAGGCGG + Intronic
1151971245 17:77458521-77458543 GACCATAGCTCTAGGAGAGGAGG - Intronic
1152220721 17:79063818-79063840 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1152602193 17:81269729-81269751 AATCACAGCACTTTGGGAGGTGG + Intronic
1152692810 17:81728078-81728100 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1152982163 18:288927-288949 AATCATAGCTACTTGGGAGGTGG + Intergenic
1153124462 18:1773864-1773886 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1153172049 18:2327630-2327652 AACCCCAGCACTTTGGGAGGAGG - Intergenic
1153346695 18:4033988-4034010 CATCCCAGCACTTTGGGAGGCGG - Intronic
1153779108 18:8478662-8478684 TTCCATAGATGTTTGGGAGGGGG + Intergenic
1154429729 18:14299225-14299247 CAGCATAGCACAATGGGAGGGGG + Intergenic
1155038758 18:22047215-22047237 AATCCTAGCACTTTGGGAGGTGG + Intergenic
1155160422 18:23190820-23190842 CATCCTAGCACTTGGGGAGGTGG + Intronic
1155969071 18:32064236-32064258 CATCCCAGCACTTTGGGAGGTGG - Intronic
1157348566 18:46863543-46863565 AATCCTAGCACTTTGGGAGGTGG - Intronic
1158096174 18:53774007-53774029 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1158869167 18:61667616-61667638 CCCAGTAGCTCTTTGGGAAGTGG - Intergenic
1159004465 18:63000330-63000352 AACCCCAGCACTTTGGGAGGCGG + Intergenic
1159099268 18:63940254-63940276 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1160200211 18:76789340-76789362 AATCTTAGCACTTTGGGAGGCGG + Intergenic
1160851286 19:1194077-1194099 AATCACAGCACTTTGGGAGGGGG - Intronic
1161182105 19:2890613-2890635 CATCCCAGCACTTTGGGAGGCGG - Intergenic
1161193768 19:2974735-2974757 ATCCATAGTACTTTGGGAGGTGG + Intergenic
1161292915 19:3505432-3505454 AATCACAGCACTTTGGGAGGTGG - Intergenic
1161332240 19:3693808-3693830 AACCCCAGCACTTTGGGAGGTGG + Intronic
1161367664 19:3890189-3890211 AATCCTAGCACTTTGGGAGGTGG - Intronic
1161392189 19:4027239-4027261 AACCCTGGCACTTTGGGAGGCGG - Intronic
1161488824 19:4550615-4550637 AATCCTAGCCCTTTGGGAGGCGG - Intronic
1161742684 19:6033041-6033063 CATCCCAGCACTTTGGGAGGTGG - Intronic
1161820212 19:6526042-6526064 CATCCCAGCACTTTGGGAGGCGG - Intergenic
1161954263 19:7484100-7484122 CATCCTAGCACTTTGGGAGGCGG + Intronic
1162046996 19:8006420-8006442 AATCCCAGCTCTTTGGGAGGCGG - Intronic
1162075836 19:8186681-8186703 CATCCCAGCACTTTGGGAGGTGG + Intronic
1162358654 19:10203623-10203645 AATCCTAGCACTTTGGGAGGCGG - Intronic
1162477050 19:10906716-10906738 AATCCTAGCACTTTGGGAGGCGG - Intronic
1162526228 19:11208530-11208552 AACCCCAGCACTTTGGGAGGCGG - Intronic
1162658981 19:12154960-12154982 AATCCTAGCACTTTGGGAGGCGG + Intronic
1162767976 19:12931512-12931534 AATCCTAGCACTTTGGGAGGCGG - Intronic
1162797516 19:13094519-13094541 CACCCTGGCTCTTTGGGAGCTGG + Intronic
1163169622 19:15521889-15521911 AATCCTAGCACTTTGGGAGGTGG + Intronic
1163204601 19:15793517-15793539 CATCTCAGCACTTTGGGAGGCGG - Intergenic
1163309533 19:16505068-16505090 AATCCTAGCACTTTGGGAGGCGG - Intronic
1163448949 19:17364336-17364358 AATCCTAGCACTTTGGGAGGCGG - Intronic
1163569270 19:18070683-18070705 AATCCTAGCACTTTGGGAGGTGG + Intronic
1163731166 19:18950127-18950149 AATCCCAGCTCTTTGGGAGGCGG + Intergenic
1164149979 19:22542305-22542327 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1164526688 19:29018230-29018252 AATCACAGCACTTTGGGAGGCGG - Intergenic
1164817129 19:31213100-31213122 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1165114294 19:33519810-33519832 AATCCTAGCACTTTGGGAGGCGG + Intronic
1165133394 19:33647590-33647612 AATCCTAGCACTTTGGGAGGCGG + Intronic
1165222496 19:34328280-34328302 AATCCTAGCACTTTGGGAGGCGG + Intronic
1165593133 19:36988205-36988227 GATCCTAGCACTTTGGGAGGTGG - Intronic
1165746824 19:38234387-38234409 AACCCCAGCACTTTGGGAGGCGG + Intergenic
1165784727 19:38454291-38454313 AATCCCAGCTCTTTGGGAGGTGG - Intronic
1166302615 19:41921101-41921123 CCCCAGAGCTGTTTGGTAGGCGG - Intronic
1166405256 19:42516777-42516799 AATCTTAGCACTTTGGGAGGTGG + Intronic
1166558132 19:43715160-43715182 AATCTTAGCGCTTTGGGAGGCGG + Intergenic
1166692658 19:44832971-44832993 AATCCTAGCACTTTGGGAGGAGG - Intergenic
1167209768 19:48126829-48126851 AATCAGAGCACTTTGGGAGGTGG - Intronic
1167398597 19:49248937-49248959 AATCACAGCACTTTGGGAGGTGG - Intergenic
1167700922 19:51045086-51045108 AATCACAGCACTTTGGGAGGCGG - Intergenic
1167950278 19:53021058-53021080 AACCCCAGCACTTTGGGAGGTGG + Intergenic
1168014066 19:53557209-53557231 AACCCCAGCACTTTGGGAGGTGG - Intronic
1168081683 19:54014735-54014757 AACCCCAGCACTTTGGGAGGCGG - Intergenic
1168526209 19:57090598-57090620 CATCCCAGCACTTTGGGAGGTGG - Intergenic
1168563413 19:57402933-57402955 CACCATGGCTCTTTGCCAGTTGG - Intronic
1168609164 19:57785507-57785529 AATCCTAGCACTTTGGGAGGCGG + Intronic
925983061 2:9192597-9192619 AATCTTAGCACTTTGGGAGGTGG - Intergenic
926619422 2:15033705-15033727 AATCTTAGCACTTTGGGAGGTGG + Intergenic
926701712 2:15808307-15808329 CAGCATAGCTGTTAGTGAGGAGG - Intergenic
926794348 2:16606652-16606674 CTCCATAGTTCTCTGGCAGGTGG + Intronic
926823170 2:16875922-16875944 CACCAAATTTTTTTGGGAGGTGG + Intergenic
927326986 2:21816276-21816298 AAGCCTAGCACTTTGGGAGGTGG - Intergenic
928136320 2:28690457-28690479 AATCACAGCACTTTGGGAGGCGG - Intergenic
928529620 2:32177880-32177902 AATCTTAGCACTTTGGGAGGCGG - Intronic
929964351 2:46522398-46522420 CACCAGGGCTTTTTGGGGGGTGG - Intronic
930431918 2:51288713-51288735 CACCCTAGCTCTTTCAGAGCTGG - Intergenic
930817601 2:55615606-55615628 AATCCTAGCACTTTGGGAGGCGG + Intronic
930985747 2:57585987-57586009 AATCACAGCACTTTGGGAGGTGG + Intergenic
931334737 2:61328041-61328063 AATCCTAGCACTTTGGGAGGCGG + Intronic
931359391 2:61565263-61565285 CACCCAGGCACTTTGGGAGGTGG - Intergenic
932038787 2:68276666-68276688 AATCCTAGCACTTTGGGAGGTGG + Intergenic
932488679 2:72104583-72104605 AATCCCAGCTCTTTGGGAGGCGG - Intergenic
933666239 2:84967448-84967470 AACCCCAGCACTTTGGGAGGCGG - Intergenic
934077101 2:88437770-88437792 AATCCTAGCACTTTGGGAGGCGG - Intergenic
934542219 2:95185167-95185189 AACCCCAGCACTTTGGGAGGTGG - Intergenic
935034197 2:99352726-99352748 AATCTTAGCGCTTTGGGAGGTGG - Intronic
935794317 2:106626660-106626682 AACCAGAGCTCTTTGAGAAGTGG - Intergenic
935985672 2:108670915-108670937 AATCCTAGCACTTTGGGAGGCGG + Intronic
936138100 2:109914545-109914567 AATCCTAGCACTTTGGGAGGCGG + Intergenic
936206596 2:110456940-110456962 AATCCTAGCACTTTGGGAGGCGG - Intronic
936269710 2:111040543-111040565 CACCAGTGCTCCTTGGGAGCAGG - Intronic
937154725 2:119710861-119710883 AACCCCAGCACTTTGGGAGGCGG - Intergenic
938846991 2:135220156-135220178 AATCCTAGCACTTTGGGAGGCGG - Intronic
941794369 2:169583772-169583794 AACCATTGCTGTTTGGGCGGGGG - Intergenic
942184544 2:173412364-173412386 AACCCCAGCACTTTGGGAGGTGG - Intergenic
942269715 2:174262089-174262111 AATCCTAGCACTTTGGGAGGCGG - Intergenic
942302666 2:174576890-174576912 CAACATAGTTTTTTGGGAAGAGG - Intronic
942398457 2:175576588-175576610 TACCAGATCACTTTGGGAGGTGG - Intergenic
942469977 2:176250249-176250271 AATCTTAGCACTTTGGGAGGCGG - Intergenic
942634711 2:177990793-177990815 AATCCTAGCACTTTGGGAGGTGG + Intronic
943005266 2:182381558-182381580 AATCCTAGCACTTTGGGAGGCGG + Intronic
944063258 2:195591750-195591772 AATCTTAGCACTTTGGGAGGAGG - Intronic
944586016 2:201174634-201174656 CCCCTCAGCACTTTGGGAGGTGG - Exonic
944954836 2:204796919-204796941 AATCTTAGCACTTTGGGAGGTGG + Intronic
945076194 2:206042426-206042448 AATCCTAGCACTTTGGGAGGCGG + Intronic
945095609 2:206216198-206216220 AATCCTAGCACTTTGGGAGGTGG + Intronic
945701043 2:213171087-213171109 CATCCCAGCACTTTGGGAGGTGG + Intergenic
945958854 2:216111266-216111288 AATCCTAGCACTTTGGGAGGCGG + Intronic
946627841 2:221634000-221634022 AACCCCAGCACTTTGGGAGGCGG + Intergenic
946828300 2:223701569-223701591 AATCCCAGCTCTTTGGGAGGTGG - Intergenic
947109181 2:226699980-226700002 AATCTTAGCACTTTGGGAGGCGG + Intergenic
947836791 2:233181604-233181626 CAGCAGAGCACTTTGGGAAGGGG - Intronic
948450853 2:238070424-238070446 AATCCTAGCACTTTGGGAGGTGG + Intronic
949008394 2:241664273-241664295 AATCCTAGCACTTTGGGAGGTGG + Intronic
1169444602 20:5660808-5660830 AATCCTAGCACTTTGGGAGGTGG + Intergenic
1170971374 20:21119807-21119829 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1171226574 20:23446507-23446529 CATCCCAGCACTTTGGGAGGCGG - Intergenic
1173816447 20:45992363-45992385 GACCCCAGCACTTTGGGAGGCGG + Intergenic
1174450621 20:50617873-50617895 AATCTTAGCACTTTGGGAGGCGG - Intronic
1175098618 20:56561943-56561965 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1175683592 20:61009638-61009660 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1175849311 20:62080085-62080107 CATCCCAGCACTTTGGGAGGCGG - Intergenic
1175849684 20:62082864-62082886 CATCCCAGCACTTTGGGAGGCGG + Intergenic
1176237575 20:64061042-64061064 AATCCTAGCACTTTGGGAGGTGG - Intronic
1176583637 21:8552540-8552562 AATCTTAGCACTTTGGGAGGCGG + Intergenic
1176896679 21:14386913-14386935 CAGCATACCTTTTTTGGAGGGGG - Intergenic
1177179752 21:17732207-17732229 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1177255319 21:18654048-18654070 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1177324257 21:19563448-19563470 AGACCTAGCTCTTTGGGAGGAGG - Intergenic
1177455232 21:21329198-21329220 AATCTTAGCACTTTGGGAGGCGG - Intronic
1178285513 21:31322431-31322453 CACGATACCTCTATGGGTGGGGG + Intronic
1178325628 21:31643086-31643108 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1178427968 21:32494051-32494073 AATCCTAGCACTTTGGGAGGCGG - Intronic
1178442552 21:32611048-32611070 AATCCTAGCACTTTGGGAGGCGG + Intronic
1178507477 21:33174402-33174424 AATCTCAGCTCTTTGGGAGGTGG + Intergenic
1178891357 21:36523491-36523513 AATCACAGCACTTTGGGAGGCGG + Intronic
1179033689 21:37741869-37741891 CACCAGAACTCTTTGGGTTGTGG + Intronic
1179345265 21:40550269-40550291 AATCCTAGCACTTTGGGAGGCGG + Intronic
1179571563 21:42281677-42281699 CACCAGGGCTCTCGGGGAGGGGG - Intronic
1180208885 21:46281566-46281588 TATCCTAGCACTTTGGGAGGTGG + Intronic
1180266447 22:10529473-10529495 AATCTTAGCACTTTGGGAGGCGG + Intergenic
1180668463 22:17533965-17533987 AATCCTAGCACTTTGGGAGGCGG - Intronic
1180799856 22:18626678-18626700 CACCAAATGTCTTTGGGAGGTGG - Intergenic
1181221859 22:21368588-21368610 CACCAAATGTCTTTGGGAGGTGG + Intergenic
1181637248 22:24180228-24180250 CACCAAATGTCTTTGGGAGGTGG + Intergenic
1181739693 22:24910998-24911020 AACCTCAGCACTTTGGGAGGTGG + Intronic
1181745960 22:24955032-24955054 AATCCTAGCACTTTGGGAGGCGG - Intronic
1182291529 22:29283785-29283807 CACCCCAGCACTTTGGGAGGTGG - Intronic
1182488505 22:30654235-30654257 AATCCTAGCACTTTGGGAGGCGG - Intronic
1182635797 22:31725920-31725942 AATCCTAGCACTTTGGGAGGCGG - Intronic
1183304281 22:37074000-37074022 AATCCTAGCACTTTGGGAGGCGG - Intronic
1183458407 22:37935183-37935205 AATCCTAGCACTTTGGGAGGCGG - Intronic
1183500811 22:38177715-38177737 AACCCCAGCACTTTGGGAGGTGG - Intronic
1185364429 22:50430618-50430640 CATCCCAGCACTTTGGGAGGCGG + Intronic
949356106 3:3182231-3182253 AACCCCAGCACTTTGGGAGGTGG - Intergenic
950826496 3:15828346-15828368 AATCACAGCACTTTGGGAGGTGG + Intronic
951546575 3:23831957-23831979 AACCTCAGCACTTTGGGAGGCGG - Intronic
951678164 3:25265723-25265745 AACCCTAGCACTTTGGGAGGCGG - Intronic
952069601 3:29618239-29618261 AATCCTAGCACTTTGGGAGGCGG + Intronic
953634912 3:44654878-44654900 AATCCTAGCACTTTGGGAGGCGG + Intronic
953933765 3:47021893-47021915 AATCCTAGCACTTTGGGAGGCGG + Intronic
954359571 3:50113105-50113127 AATCCTAGCACTTTGGGAGGTGG - Intronic
954551222 3:51483180-51483202 AATCCTAGCACTTTGGGAGGAGG + Intronic
954724802 3:52598765-52598787 AATCCTAGCACTTTGGGAGGCGG + Intronic
954726171 3:52612648-52612670 AATCCTAGCACTTTGGGAGGCGG + Intronic
954961754 3:54571694-54571716 CATCACATCTATTTGGGAGGTGG + Intronic
956307532 3:67842490-67842512 AATCCTAGCACTTTGGGAGGCGG - Intergenic
956363553 3:68474403-68474425 CACCATAGCTCTTAGTAATGGGG - Intronic
956383846 3:68695865-68695887 AATCCTAGCACTTTGGGAGGCGG + Intergenic
957105402 3:75880939-75880961 AATCCTAGCACTTTGGGAGGCGG - Intergenic
957187981 3:76967458-76967480 AATCCTAGCACTTTGGGAGGTGG - Intronic
957780181 3:84809260-84809282 CCTGATAGATCTTTGGGAGGTGG - Intergenic
958513015 3:95073395-95073417 AATCCTAGCACTTTGGGAGGTGG + Intergenic
958591462 3:96163704-96163726 CATCCTAGCACTTTGGGAGGCGG + Intergenic
958798473 3:98731543-98731565 TACCAGAGCACTTTGGCAGGTGG + Intergenic
958895617 3:99826027-99826049 AATCCTAGCACTTTGGGAGGCGG - Intronic
958930396 3:100201681-100201703 AATCTTAGCACTTTGGGAGGTGG - Intergenic
959035921 3:101363962-101363984 GATCCTAGCACTTTGGGAGGTGG + Intronic
959663712 3:108897839-108897861 AATCCTAGCACTTTGGGAGGCGG - Intergenic
960791836 3:121440587-121440609 AATCCTAGCACTTTGGGAGGCGG - Intronic
961246246 3:125456405-125456427 AATCCTAGCACTTTGGGAGGCGG + Intronic
961775452 3:129280968-129280990 AATCCTAGCACTTTGGGAGGTGG + Intronic
962049541 3:131798165-131798187 CAACATATGTATTTGGGAGGGGG + Intronic
962288603 3:134109816-134109838 CATCCCAGCACTTTGGGAGGCGG - Intronic
963172650 3:142266612-142266634 AATCATAGCACTGTGGGAGGTGG + Intergenic
963651984 3:147991533-147991555 AACCTCAGCACTTTGGGAGGTGG + Intergenic
964422634 3:156520325-156520347 AATCCTAGCACTTTGGGAGGTGG + Intronic
965245909 3:166268302-166268324 AACCCCAGCACTTTGGGAGGTGG + Intergenic
965876131 3:173322512-173322534 AACCCCAGCACTTTGGGAGGCGG - Intergenic
965967141 3:174506432-174506454 AATCCTAGCACTTTGGGAGGCGG - Intronic
966031581 3:175355321-175355343 AATCACAGCACTTTGGGAGGAGG - Intronic
966119268 3:176504136-176504158 AACTGTAACTCTTTGGGAGGTGG + Intergenic
966625672 3:182013772-182013794 AATCCTAGCACTTTGGGAGGCGG - Intergenic
966929826 3:184669142-184669164 AACAATATCTCTGTGGGAGGGGG + Intronic
967109777 3:186283152-186283174 AACCCCAGCACTTTGGGAGGCGG - Intronic
967213935 3:187194206-187194228 GATCTTAGCACTTTGGGAGGTGG + Intergenic
967643291 3:191894662-191894684 CTCCATAGCTCTTTGAAATGTGG + Intergenic
968163403 3:196445343-196445365 AATCCTAGCACTTTGGGAGGTGG - Intergenic
968847640 4:3054964-3054986 AATCCTAGCACTTTGGGAGGTGG - Intergenic
969671305 4:8591851-8591873 CACCCCAGCTCTCAGGGAGGAGG + Intronic
969846206 4:9922303-9922325 CACCAGAGCCCATTGGGGGGTGG + Intronic
971233461 4:24819572-24819594 AATCCTAGCACTTTGGGAGGTGG - Intronic
971707228 4:30060936-30060958 CAGCATAGAACTATGGGAGGAGG - Intergenic
972259259 4:37391948-37391970 CATCCCAGCACTTTGGGAGGCGG + Intronic
972590046 4:40476979-40477001 CATCCCAGCACTTTGGGAGGCGG + Intronic
973712572 4:53644145-53644167 CATCCTAGCACTTTGGGATGGGG + Intronic
975701158 4:77067922-77067944 AATCCTAGCACTTTGGGAGGTGG + Intronic
976244177 4:82990734-82990756 AATCCTAGCACTTTGGGAGGCGG - Intronic
977259969 4:94786477-94786499 AATCCTAGCTATTTGGGAGGTGG - Intronic
977411860 4:96676025-96676047 CATCATAGGTCCTTGGGTGGGGG + Intergenic
977773807 4:100893513-100893535 AATCCTAGCACTTTGGGAGGCGG + Intergenic
977957747 4:103049756-103049778 AATCCTAGCACTTTGGGAGGGGG + Intronic
978789286 4:112643987-112644009 AATCCTAGCACTTTGGGAGGCGG + Intronic
979534948 4:121808926-121808948 AATCCTAGCACTTTGGGAGGTGG - Intronic
979847272 4:125531498-125531520 AATCCTAGCACTTTGGGAGGTGG - Intergenic
979963903 4:127054402-127054424 CACCACAGCTCTTGAGAAGGTGG + Intergenic
980591434 4:134894428-134894450 GATCCTAGCCCTTTGGGAGGTGG - Intergenic
980932542 4:139195504-139195526 AATCCTAGCACTTTGGGAGGCGG - Intergenic
981164898 4:141546022-141546044 AACCATAGCTCTTTGAAAGCAGG + Intergenic
981484239 4:145268369-145268391 AATCATAGCATTTTGGGAGGCGG - Intergenic
982417063 4:155146599-155146621 AATCCTAGCACTTTGGGAGGCGG - Intergenic
983294894 4:165854419-165854441 AATCCTAGCACTTTGGGAGGCGG + Intergenic
983327216 4:166272510-166272532 AATCCTAGCACTTTGGGAGGTGG - Intergenic
985263093 4:188133053-188133075 AATCCTAGCACTTTGGGAGGCGG + Intergenic
986668372 5:10122810-10122832 AATCCTAGCACTTTGGGAGGCGG + Intergenic
986881238 5:12174084-12174106 CATCCCAGCACTTTGGGAGGCGG - Intergenic
987320964 5:16768927-16768949 AACCCCAGCACTTTGGGAGGTGG - Intronic
988508986 5:31849588-31849610 AATCCTAGCACTTTGGGAGGCGG + Intronic
988530911 5:32026389-32026411 CATCTCAGCACTTTGGGAGGCGG - Intronic
989016561 5:36942177-36942199 AATCCCAGCTCTTTGGGAGGCGG + Intronic
991696239 5:69275718-69275740 AATCCTAGCTCTTAGGGAGGCGG + Intronic
992838345 5:80662571-80662593 AATCACAGCACTTTGGGAGGCGG + Intronic
992958981 5:81939915-81939937 AATCCTAGCACTTTGGGAGGTGG - Intergenic
993690286 5:90991530-90991552 AATCCTAGCACTTTGGGAGGTGG - Intronic
994490023 5:100429771-100429793 CACCACAGCTCTTAGGTAAGTGG - Intergenic
996721447 5:126634176-126634198 GATCCTAGCACTTTGGGAGGCGG + Intronic
996746746 5:126852720-126852742 CATCCCAGCACTTTGGGAGGCGG - Intergenic
997132385 5:131290098-131290120 AATCGTAGCACTTTGGGAGGTGG - Intronic
997504994 5:134410376-134410398 AATCCTAGCACTTTGGGAGGAGG - Intronic
997592479 5:135084047-135084069 CACCAGAGACCTGTGGGAGGAGG - Intronic
997646544 5:135485952-135485974 CACCATAGCCTCTTGGGAAGGGG - Intergenic
997704625 5:135936381-135936403 TACCATAGCTCTTTGAGAACAGG + Intronic
998094334 5:139388745-139388767 CCCCAAAGCTCTCTGGGATGGGG + Intronic
998565372 5:143211806-143211828 AATCCTAGCACTTTGGGAGGTGG - Intronic
999214339 5:149919251-149919273 AATCCTAGCACTTTGGGAGGCGG + Intronic
999741810 5:154561327-154561349 AATCCTAGCACTTTGGGAGGAGG + Intergenic
999753659 5:154648432-154648454 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1000215277 5:159149379-159149401 AACCCCAGCACTTTGGGAGGCGG - Intergenic
1000410810 5:160933966-160933988 CATCATAGCTCTCTTGGGGGAGG - Intergenic
1001169954 5:169409964-169409986 TGCCATATCTCTTTGGGAGATGG - Intergenic
1001298931 5:170519541-170519563 CACATTGGCTCTTTGGGAAGAGG + Intronic
1001819992 5:174703016-174703038 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1002564809 5:180105307-180105329 CATCCCAGCACTTTGGGAGGCGG + Intronic
1002621813 5:180493762-180493784 CATCCCAGCACTTTGGGAGGCGG + Intergenic
1003563391 6:7202434-7202456 CACCTAAGCTCTGTAGGAGGAGG - Intronic
1003829257 6:9988638-9988660 AATCCTAGCACTTTGGGAGGCGG + Intronic
1003886927 6:10530106-10530128 AATCACAGCACTTTGGGAGGCGG + Intronic
1003968146 6:11272995-11273017 GACCCTATCTCTGTGGGAGGCGG - Intronic
1004679750 6:17881740-17881762 AACCCTAGCACTTTGGGAGGTGG + Intronic
1004693383 6:18011829-18011851 AATCACAGCACTTTGGGAGGTGG + Intergenic
1005057157 6:21740080-21740102 GTCCAGAGCTCTTTAGGAGGTGG + Intergenic
1006374144 6:33662650-33662672 CTCCAATGCTCTCTGGGAGGTGG + Exonic
1006470526 6:34226270-34226292 CACCACACCTCTTTGGGAACTGG + Intergenic
1006999453 6:38295793-38295815 AATCCCAGCTCTTTGGGAGGCGG + Intronic
1007453052 6:41954650-41954672 AATCCTAGCACTTTGGGAGGTGG - Intronic
1007573476 6:42909875-42909897 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1008609692 6:53174376-53174398 AATCTTAGCACTTTGGGAGGCGG + Intergenic
1008725892 6:54418386-54418408 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1009420752 6:63461601-63461623 CAGCATATCTCTTCTGGAGGTGG - Intergenic
1009658720 6:66581167-66581189 CATCCTAGCACTTTGAGAGGCGG + Intergenic
1010230567 6:73530998-73531020 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1010913486 6:81587406-81587428 CACCAGGGCCCGTTGGGAGGTGG - Intronic
1011045215 6:83074225-83074247 CTCCATGGTCCTTTGGGAGGGGG + Intronic
1011422928 6:87193289-87193311 AATCCTAGCACTTTGGGAGGCGG + Intronic
1012494511 6:99819507-99819529 AAACCTAGCACTTTGGGAGGCGG - Intergenic
1013216124 6:108028792-108028814 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1013789950 6:113825447-113825469 AACCCTAGCAATTTGGGAGGCGG - Intergenic
1013846753 6:114462068-114462090 AAGCTTAGCACTTTGGGAGGCGG - Intergenic
1014325096 6:119984293-119984315 TATCCTAGCACTTTGGGAGGTGG - Intergenic
1014395164 6:120918998-120919020 AACCCCAGCACTTTGGGAGGTGG + Intergenic
1014675780 6:124363445-124363467 CAGCATAGCTTTGAGGGAGGTGG + Intronic
1014991709 6:128088122-128088144 AACCCTAGCACTTTGGGAGGCGG + Intronic
1015301639 6:131659192-131659214 AATCCTAGCACTTTGGGAGGTGG + Intronic
1015537077 6:134277118-134277140 AACCCCAGCACTTTGGGAGGAGG + Intronic
1015711942 6:136151686-136151708 AATCCTAGCACTTTGGGAGGCGG + Intronic
1015714417 6:136177207-136177229 AATCCTAGCACTTTGGGAGGTGG + Intronic
1016464256 6:144309944-144309966 CACAGTAGCTCTCTGAGAGGAGG - Intronic
1016652651 6:146480834-146480856 AATCCTAGCACTTTGGGAGGAGG + Intergenic
1017125132 6:151058028-151058050 AATCCTAGCACTTTGGGAGGTGG - Intronic
1018183230 6:161242815-161242837 CATCCCAGCACTTTGGGAGGGGG + Intronic
1018187200 6:161276049-161276071 AATCACAGCACTTTGGGAGGTGG - Intergenic
1018506115 6:164471393-164471415 AACCTCAGCACTTTGGGAGGTGG - Intergenic
1019509299 7:1409319-1409341 CATCCCAGCACTTTGGGAGGGGG + Intergenic
1019575319 7:1734946-1734968 CATCCCAGCACTTTGGGAGGCGG - Intronic
1019619138 7:1981218-1981240 CATCCCAGCACTTTGGGAGGCGG - Intronic
1019998770 7:4742668-4742690 AACCTCAGCACTTTGGGAGGTGG - Intronic
1020197207 7:6050446-6050468 AATCCTAGCACTTTGGGAGGTGG - Intronic
1020991759 7:15206198-15206220 TACCATAGCTCTTTAGGAACTGG + Intronic
1021338615 7:19435031-19435053 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1021753734 7:23830871-23830893 AATCCCAGCTCTTTGGGAGGTGG - Intronic
1022260911 7:28703961-28703983 CATCTTAGCTCTTTAGCAGGTGG + Intronic
1022730483 7:33018595-33018617 AACCCCAGCACTTTGGGAGGCGG + Intronic
1023061138 7:36328310-36328332 AATCACAGCACTTTGGGAGGTGG - Intronic
1023116128 7:36864429-36864451 CACCAAAGCTGCCTGGGAGGGGG + Intronic
1023741658 7:43286680-43286702 CCCCAAAGGTGTTTGGGAGGAGG + Intronic
1023829413 7:44030140-44030162 TATCCCAGCTCTTTGGGAGGTGG - Intergenic
1023975729 7:45028402-45028424 AATCCTAGCACTTTGGGAGGTGG + Intronic
1024643193 7:51348684-51348706 AATCACAGCACTTTGGGAGGCGG + Intergenic
1025242893 7:57292865-57292887 AATCCTAGCACTTTGGGAGGTGG + Intergenic
1025613754 7:63100513-63100535 CTCCACAGCTCTTTGAGAGCTGG + Intergenic
1025694484 7:63767839-63767861 AATCACAGCACTTTGGGAGGTGG + Intergenic
1025980118 7:66398451-66398473 AATCCCAGCTCTTTGGGAGGTGG - Intronic
1026063176 7:67044871-67044893 AATCCTAGCACTTTGGGAGGTGG - Intronic
1026243725 7:68599496-68599518 AATCATAGCACTTTGGGAGGTGG + Intergenic
1026715172 7:72782621-72782643 AATCCTAGCACTTTGGGAGGTGG + Intronic
1026741020 7:72978598-72978620 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1026922830 7:74169096-74169118 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1026940430 7:74284716-74284738 AATCACAGCACTTTGGGAGGTGG - Intergenic
1027102713 7:75386476-75386498 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1027144070 7:75681752-75681774 AATCCTAGCACTTTGGGAGGTGG - Intronic
1028149773 7:87358222-87358244 AATCCTAGCACTTTGGGAGGCGG + Intronic
1029030100 7:97458178-97458200 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1029130294 7:98325129-98325151 AATCCTAGCACTTTGGGAGGCGG + Intronic
1029375210 7:100173221-100173243 AATCCTAGCACTTTGGGAGGCGG - Intronic
1029605523 7:101597406-101597428 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1029689584 7:102172333-102172355 AACCCCAGCACTTTGGGAGGTGG - Intronic
1029706953 7:102281123-102281145 CATCCCAGCACTTTGGGAGGTGG + Intronic
1029739720 7:102484398-102484420 TATCCCAGCTCTTTGGGAGGTGG - Intronic
1029757721 7:102583577-102583599 TATCCCAGCTCTTTGGGAGGTGG - Intronic
1029775657 7:102682638-102682660 TATCCCAGCTCTTTGGGAGGTGG - Intergenic
1029834630 7:103296543-103296565 AATCCTAGCACTTTGGGAGGTGG + Intergenic
1031908077 7:127483576-127483598 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1032261341 7:130339672-130339694 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1033178718 7:139152893-139152915 AATCCTAGCACTTTGGGAGGCGG + Intronic
1033408910 7:141098043-141098065 AATCTTAGCACTTTGGGAGGCGG - Intronic
1033641482 7:143266282-143266304 AAACACAGCACTTTGGGAGGTGG - Intronic
1033664227 7:143425424-143425446 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1034154855 7:148948361-148948383 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1034537124 7:151732390-151732412 CATCCCAGCACTTTGGGAGGCGG - Intronic
1034923445 7:155102166-155102188 CATCCTAGCACTTTGGGAGGTGG - Intergenic
1035124553 7:156598499-156598521 AACCCCAGCACTTTGGGAGGTGG + Intergenic
1035580162 8:734907-734929 CATCTTAGCACTTTGGGAGGCGG + Intronic
1035897156 8:3416046-3416068 AATCCTAGCACTTTGGGAGGCGG + Intronic
1035958794 8:4113655-4113677 AATCCTAGCACTTTGGGAGGTGG - Intronic
1036080539 8:5550594-5550616 CATTTGAGCTCTTTGGGAGGTGG - Intergenic
1036411925 8:8510151-8510173 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1037040264 8:14222419-14222441 AATCTTAGCACTTTGGGAGGCGG - Intronic
1037046635 8:14313433-14313455 AATCCTAGCTATTTGGGAGGAGG - Intronic
1037682411 8:21108486-21108508 AATCCTAGCACTTTGGGAGGAGG + Intergenic
1038324136 8:26559194-26559216 AATCCTAGCACTTTGGGAGGCGG - Intronic
1038707001 8:29903621-29903643 CACCATAGCTCTTTAATAAGTGG - Intergenic
1038812123 8:30858549-30858571 AATCCTAGCACTTTGGGAGGCGG - Intronic
1039799000 8:40938333-40938355 AACCCCAGCACTTTGGGAGGCGG + Intergenic
1039935586 8:42041481-42041503 AATCCTAGCACTTTGGGAGGCGG + Intronic
1039961282 8:42249821-42249843 CATCCTGGCACTTTGGGAGGTGG + Intergenic
1039995305 8:42527150-42527172 AACCCCAGCACTTTGGGAGGCGG + Intronic
1040558047 8:48498557-48498579 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1041217123 8:55611729-55611751 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1042546468 8:69955753-69955775 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1042926140 8:73970765-73970787 AATCGTAGCTCTTTGGGAGGTGG + Intronic
1042965252 8:74344463-74344485 AATCCTAGCACTTTGGGAGGCGG + Intronic
1044005817 8:86935888-86935910 AATCCTAGCACTTTGGGAGGTGG + Intronic
1044843210 8:96355692-96355714 AACCACAGAGCTTTGGGAGGTGG + Intergenic
1044983864 8:97741148-97741170 AATCTCAGCTCTTTGGGAGGTGG - Intergenic
1045106437 8:98897302-98897324 AATCCTAGCACTTTGGGAGGTGG + Intronic
1045220352 8:100192875-100192897 AATCCTAGCACTTTGGGAGGTGG - Intronic
1045404065 8:101847687-101847709 CACCAAAGCTCTTTGAGGGTAGG - Intronic
1045687350 8:104726112-104726134 AATCCTAGCACTTTGGGAGGTGG + Intronic
1045909771 8:107393554-107393576 AATCCTAGCACTTTGGGAGGTGG + Intronic
1047118000 8:121867019-121867041 AATCCTAGCACTTTGGGAGGAGG - Intergenic
1047157950 8:122342567-122342589 AATCCTAGCACTTTGGGAGGAGG - Intergenic
1047477357 8:125246433-125246455 AATCCTAGCACTTTGGGAGGAGG - Intronic
1047580709 8:126212338-126212360 CACCATAGCTCTTTCTGTGGCGG - Intergenic
1047598181 8:126399790-126399812 AATCTTAGCACTTTGGGAGGCGG + Intergenic
1047603755 8:126453541-126453563 AATCCTAGCGCTTTGGGAGGCGG + Intergenic
1048664183 8:136642647-136642669 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1048970272 8:139641489-139641511 GACCATTGCTGTTTTGGAGGTGG + Intronic
1049033674 8:140057917-140057939 CACCAGAGCTCTAGTGGAGGTGG + Intronic
1049142177 8:140964657-140964679 GATCCTAGCACTTTGGGAGGCGG - Intronic
1049566551 8:143343012-143343034 AATCCTAGCACTTTGGGAGGCGG - Intronic
1049806160 8:144541102-144541124 CATCCCAGCACTTTGGGAGGCGG - Intronic
1049989015 9:975437-975459 CACAATAGCTCTATGCGAAGCGG - Intergenic
1050641482 9:7672624-7672646 AATCTTAGCGCTTTGGGAGGCGG + Intergenic
1051071483 9:13173447-13173469 AATCCTAGCACTTTGGGAGGCGG + Intronic
1051145201 9:14019920-14019942 AACCCCAGCACTTTGGGAGGCGG + Intergenic
1051765475 9:20518084-20518106 AATCCTAGCACTTTGGGAGGTGG + Intronic
1052153286 9:25147982-25148004 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1052938861 9:34116108-34116130 AATCCTAGCACTTTGGGAGGTGG + Intronic
1053006531 9:34608546-34608568 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1054527759 9:66151965-66151987 AATCCTAGCGCTTTGGGAGGCGG + Intronic
1054716512 9:68562276-68562298 CATCACAGCTACTTGGGAGGCGG + Intergenic
1055457663 9:76487985-76488007 GATCCTAGCACTTTGGGAGGTGG - Intronic
1055637604 9:78294223-78294245 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1056428882 9:86506941-86506963 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1056636695 9:88337282-88337304 AATCATAGCACTTTGGGAGGTGG + Intergenic
1057120090 9:92563800-92563822 CACCACCCCACTTTGGGAGGAGG - Intronic
1057246935 9:93464444-93464466 TACCATATTTCTTGGGGAGGGGG + Intronic
1057728766 9:97590477-97590499 TATCCTAGCACTTTGGGAGGCGG - Intronic
1058156281 9:101519410-101519432 AATCCTAGCACTTTGGGAGGGGG - Intronic
1058430733 9:104916796-104916818 AATCACAGCACTTTGGGAGGTGG - Intronic
1060002533 9:119971273-119971295 CACCAGACCTCTTTGTGAAGAGG + Intergenic
1060138712 9:121184509-121184531 TACCATATCTGTTTGGAAGGGGG - Intronic
1060612176 9:124977424-124977446 AATCCCAGCTCTTTGGGAGGTGG + Intronic
1060658511 9:125388929-125388951 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1061501814 9:131008450-131008472 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1061517619 9:131098605-131098627 CAACCTAGCCCTTGGGGAGGTGG + Intronic
1061770606 9:132917583-132917605 AATCCTAGCACTTTGGGAGGCGG - Intronic
1061836004 9:133330481-133330503 AATCCCAGCTCTTTGGGAGGCGG - Intergenic
1061876713 9:133547721-133547743 CACCATAGTGCCTGGGGAGGGGG - Intronic
1185476876 X:420602-420624 CATCCCAGCACTTTGGGAGGCGG - Intergenic
1185485779 X:481177-481199 CACCACAGCACTTTGGAAGCTGG - Intergenic
1185565509 X:1092295-1092317 CATCCCAGCACTTTGGGAGGCGG + Intergenic
1185589077 X:1261960-1261982 CATCCCAGCACTTTGGGAGGTGG - Intergenic
1185649161 X:1636208-1636230 AATCCTAGCACTTTGGGAGGCGG - Intronic
1185774689 X:2793155-2793177 CAACCCAGCACTTTGGGAGGTGG - Intronic
1185780979 X:2846318-2846340 CACTTTGGCACTTTGGGAGGCGG - Intronic
1185969150 X:4642577-4642599 TACCTTAGCTCTTTGGGTTGAGG + Intergenic
1186567744 X:10682050-10682072 AATCCTAGCACTTTGGGAGGTGG + Intronic
1186666737 X:11724422-11724444 CCCAATAGCTTTTGGGGAGGTGG - Intergenic
1186744441 X:12552900-12552922 AATCCTAGCACTTTGGGAGGTGG + Intronic
1187303524 X:18074360-18074382 CACTATGGCTCTTTGGGCTGGGG + Intergenic
1188092699 X:25982722-25982744 CACCATGGCTGGTTGGGGGGTGG + Intergenic
1190069155 X:47265344-47265366 AACCCTAGCACTTTGGGAGGTGG - Intergenic
1190803606 X:53814367-53814389 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1190869465 X:54413182-54413204 CACCCCAACACTTTGGGAGGCGG - Intergenic
1192323180 X:70108762-70108784 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1192443073 X:71189450-71189472 AACCCCAGCACTTTGGGAGGCGG - Intergenic
1192461995 X:71324812-71324834 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1192490825 X:71576123-71576145 AACCCCAGCACTTTGGGAGGCGG + Intergenic
1193629853 X:83870758-83870780 CAACATAGCTCTCTTGGAGATGG - Intronic
1194667223 X:96688588-96688610 AATCCTAGCACTTTGGGAGGTGG - Intronic
1195380319 X:104264486-104264508 AATCCTAGCACTTTGGGAGGTGG + Intergenic
1195506093 X:105658705-105658727 AACCCCAGCACTTTGGGAGGTGG + Intronic
1195682475 X:107559219-107559241 AATCACAGCACTTTGGGAGGCGG - Intronic
1195745423 X:108112646-108112668 AATCCTAGCACTTTGGGAGGCGG - Intronic
1196197681 X:112853116-112853138 TTCCATAGCTCTTTGGAAGAAGG + Intergenic
1196295103 X:113988157-113988179 CACCATTGCTCTTCTGGAGCAGG - Intergenic
1196344948 X:114644087-114644109 AATCCCAGCTCTTTGGGAGGCGG + Intronic
1197049599 X:122042644-122042666 CACCTGAGCTCCTTGGGAGAGGG - Intergenic
1197331621 X:125159944-125159966 AATCCTAGCGCTTTGGGAGGTGG + Intergenic
1197751644 X:129968073-129968095 AATCCTAGCACTTTGGGAGGCGG - Intergenic
1198082617 X:133253370-133253392 AATCCTAGCACTTTGGGAGGTGG + Intergenic
1198464810 X:136895357-136895379 AATCCTAGCACTTTGGGAGGTGG - Intergenic
1198613107 X:138424047-138424069 CACCATAGTTCTTTTGGTGATGG + Intergenic
1200082659 X:153586357-153586379 CATCCCAGCTCTTTGGGAAGCGG - Intergenic
1200172348 X:154086512-154086534 AATCCTAGCACTTTGGGAGGTGG - Intronic
1200622100 Y:5462887-5462909 AATCCTAGCACTTTGGGAGGCGG - Intronic
1201694676 Y:16811845-16811867 AATCCTAGCACTTTGGGAGGCGG + Intergenic
1201696212 Y:16829273-16829295 AACCATTGTTCTTTTGGAGGAGG + Intergenic