ID: 1070499914

View in Genome Browser
Species Human (GRCh38)
Location 10:77062982-77063004
Sequence AGCTATGGTGATGGGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070499903_1070499914 23 Left 1070499903 10:77062936-77062958 CCAGCCATGCAACCAGAAGTCAT 0: 1
1: 0
2: 0
3: 14
4: 125
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data
1070499901_1070499914 28 Left 1070499901 10:77062931-77062953 CCCAACCAGCCATGCAACCAGAA 0: 1
1: 0
2: 1
3: 24
4: 167
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data
1070499900_1070499914 29 Left 1070499900 10:77062930-77062952 CCCCAACCAGCCATGCAACCAGA 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data
1070499906_1070499914 -3 Left 1070499906 10:77062962-77062984 CCGATTTCCTCCTCCCAAAGAGC 0: 1
1: 0
2: 19
3: 674
4: 14038
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data
1070499902_1070499914 27 Left 1070499902 10:77062932-77062954 CCAACCAGCCATGCAACCAGAAG 0: 1
1: 0
2: 1
3: 23
4: 216
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data
1070499904_1070499914 19 Left 1070499904 10:77062940-77062962 CCATGCAACCAGAAGTCATCTTC 0: 1
1: 0
2: 1
3: 25
4: 216
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data
1070499905_1070499914 11 Left 1070499905 10:77062948-77062970 CCAGAAGTCATCTTCCGATTTCC No data
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data
1070499908_1070499914 -10 Left 1070499908 10:77062969-77062991 CCTCCTCCCAAAGAGCTATGGTG 0: 1
1: 0
2: 0
3: 30
4: 745
Right 1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070499914 Original CRISPR AGCTATGGTGATGGGTCCTG TGG Intronic
No off target data available for this crispr