ID: 1070504158

View in Genome Browser
Species Human (GRCh38)
Location 10:77098366-77098388
Sequence GAGTACCCATTGGCCTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070504158_1070504161 -8 Left 1070504158 10:77098366-77098388 CCAAGTGAGGCCAATGGGTACTC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1070504161 10:77098381-77098403 GGGTACTCTTAAATCTTGGATGG No data
1070504158_1070504162 -7 Left 1070504158 10:77098366-77098388 CCAAGTGAGGCCAATGGGTACTC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1070504162 10:77098382-77098404 GGTACTCTTAAATCTTGGATGGG No data
1070504158_1070504163 12 Left 1070504158 10:77098366-77098388 CCAAGTGAGGCCAATGGGTACTC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1070504163 10:77098401-77098423 TGGGCTGATGCTAATCACAGTGG No data
1070504158_1070504164 13 Left 1070504158 10:77098366-77098388 CCAAGTGAGGCCAATGGGTACTC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1070504164 10:77098402-77098424 GGGCTGATGCTAATCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070504158 Original CRISPR GAGTACCCATTGGCCTCACT TGG (reversed) Intronic
901941920 1:12668856-12668878 CTGTAACCATTGGCCTGACTTGG + Intergenic
904564538 1:31420488-31420510 CAGTACCCACTGGCCTCCCTTGG + Intronic
908996527 1:70162507-70162529 TAGTGTCCATTGGCCTCACCTGG - Intronic
914388953 1:147200837-147200859 GAGTACACATTGGAATTACTGGG + Intronic
922894522 1:229089870-229089892 CAGTACTCATTGGCTCCACTGGG - Intergenic
1068587513 10:58815964-58815986 CAGTAGCCATTGGCCACACATGG - Intronic
1069779433 10:70945560-70945582 GAGCACCCATTGGATTCAATGGG + Intergenic
1070504158 10:77098366-77098388 GAGTACCCATTGGCCTCACTTGG - Intronic
1075667196 10:124239858-124239880 GAATACACAGTGTCCTCACTGGG + Intergenic
1077189976 11:1251888-1251910 GGGTCCCCACTGGCCACACTGGG + Intronic
1077189989 11:1251948-1251970 CAGTCCCCACTGGCCACACTTGG + Intronic
1077190026 11:1252088-1252110 CAGTCCCCACTGGCCACACTCGG + Intronic
1081297361 11:41408411-41408433 GACTCCCCATTAGCCCCACTTGG + Intronic
1082303301 11:50538179-50538201 TATTAGCCATTGGCCTCAATGGG + Intergenic
1084209260 11:67613472-67613494 GAGTAACCATTGGCATCCATGGG + Intergenic
1084562280 11:69911695-69911717 GCCTCCCCATTGGCCTCCCTGGG - Intergenic
1088924453 11:114286106-114286128 GAGTACCATTTAGCCCCACTGGG + Intronic
1090270661 11:125383745-125383767 AAGTATCCATTGGCCTCATGGGG + Intronic
1094126767 12:27031905-27031927 GCGTACCCCTTGGCCCCACTTGG + Intronic
1102463854 12:113116440-113116462 GTGTTCCCATTGGCCTCTCTTGG - Intronic
1106151751 13:27110543-27110565 GAGAAGTCATTGTCCTCACTAGG - Intronic
1113652167 13:112041780-112041802 GACTCCCCAGTGGTCTCACTTGG + Intergenic
1119799432 14:77429720-77429742 GAGCACCCATTGGCTTCCATCGG - Exonic
1122231076 14:100306527-100306549 GCCCGCCCATTGGCCTCACTCGG - Exonic
1128383772 15:67132640-67132662 GAGCCCCCATTTTCCTCACTAGG + Intronic
1128513774 15:68329291-68329313 GACTTCCCATTGGAATCACTTGG + Intronic
1129727910 15:77910934-77910956 GGGTTCCCATTTCCCTCACTGGG - Intergenic
1129770664 15:78201361-78201383 GTGTCCTCATTGGCCTCCCTGGG - Intronic
1129839970 15:78737926-78737948 GGGTTCCCATTTCCCTCACTGGG + Intergenic
1132185061 15:99796980-99797002 GTGTTCCCATTTCCCTCACTGGG + Intergenic
1132431928 15:101767575-101767597 GTGTTCCCATTTCCCTCACTGGG - Intergenic
1133712718 16:8416935-8416957 CAGTACCCATTGGCCACATGTGG - Intergenic
1138090156 16:54167377-54167399 GAGTACCCAGTTGCCACACGTGG + Intergenic
1139580472 16:67870654-67870676 AAGTACCCCTTGGCTACACTGGG + Intronic
1139735808 16:68987021-68987043 GAGTTCCAATTGGCTTCACCTGG + Intronic
1142355722 16:89600860-89600882 GGGAACCCATTGGTCTCACCTGG - Intergenic
1144859295 17:18290248-18290270 GAGCACCCATTGGCCACATGAGG - Intronic
1146137518 17:30335963-30335985 GAGTACACTTTGCCCTCACAGGG - Intergenic
1149678685 17:58488426-58488448 GAGGCCCCATTGGCCGCGCTGGG - Intergenic
1151315139 17:73317214-73317236 GATTTCCCCTTGGCCTCCCTGGG + Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1152009151 17:77700275-77700297 GAGTCCTCAGTGGCCTCCCTGGG + Intergenic
1160582982 18:79898325-79898347 GAGACCCCATTGGCCTCTCCTGG + Intronic
1161117198 19:2504325-2504347 GAGTCCCCAGTGTCCTCACAGGG + Intergenic
1162286252 19:9741289-9741311 GTGTCCCCATTGACCTCATTAGG + Intergenic
1165098504 19:33424112-33424134 GACTTCCCACTGCCCTCACTGGG + Intronic
926061271 2:9806604-9806626 GTGTTCCCATTGGCCTGCCTAGG - Intergenic
940770969 2:157839234-157839256 GAGTAAGCACTGGCCTCTCTCGG + Intronic
942991484 2:182208116-182208138 GAGTCCCCATAGTCCTCACTGGG + Intronic
946616958 2:221520238-221520260 GAGTACCAGTTGTTCTCACTTGG + Intronic
948576752 2:238956725-238956747 GAGTATCCATTAGCCTAACCAGG + Intergenic
1169823366 20:9738935-9738957 CAGTAGCCATTAGCCTCACGTGG - Intronic
1173901459 20:46592727-46592749 GGGCACCCATTGGTCCCACTAGG - Intronic
1175537115 20:59722498-59722520 GAGGAGCCTCTGGCCTCACTTGG - Intronic
1184727806 22:46356645-46356667 GGGCACCCAGTGGCTTCACTAGG - Intronic
954652369 3:52172920-52172942 GGGTACCCACTGGACTCACCTGG - Intergenic
956114840 3:65907858-65907880 CAGTATCCATTTGCCTGACTTGG + Intronic
956436814 3:69242248-69242270 GAGTACCCACTGGAATCAATGGG - Intronic
960040914 3:113149057-113149079 GAATACCCAAGGGCCTGACTTGG + Intergenic
961815722 3:129549100-129549122 GGGTCCTCCTTGGCCTCACTTGG - Exonic
962568863 3:136691959-136691981 GAGTAACTATTTGCTTCACTGGG - Intronic
963951846 3:151210804-151210826 GAGAGCCCTTTGGCCTCTCTTGG + Intronic
963957304 3:151269033-151269055 GAGGAGACATTGGCCTCTCTGGG + Intronic
964705771 3:159616969-159616991 GAGTACCCATTGGCTACATGTGG - Intronic
965375214 3:167914756-167914778 CAGTAATCATTAGCCTCACTTGG - Intergenic
966766665 3:183469264-183469286 GGGAACCCTGTGGCCTCACTGGG + Intergenic
968986578 4:3878818-3878840 GAGTAACCAGTGCCCACACTAGG + Intergenic
971166235 4:24186681-24186703 GAGTACCCATTGGAGCCACTTGG + Intergenic
976338201 4:83915558-83915580 GACTCCCCATTGCCCACACTAGG + Intergenic
979286794 4:118935174-118935196 TACTTCCCAGTGGCCTCACTGGG - Intronic
980562637 4:134497863-134497885 GAGTAACCAGTTGCCTCATTTGG + Intergenic
987152585 5:15057244-15057266 CAGTACCACTTGGCCTCACAGGG + Intergenic
993692837 5:91023969-91023991 GAGTACACAGTGGAATCACTTGG + Intronic
999377911 5:151099744-151099766 GACCAGCCATTGCCCTCACTGGG - Intergenic
1003432658 6:6054141-6054163 TAGTACACATCTGCCTCACTGGG + Intergenic
1009218560 6:60953645-60953667 GAGTACTCATAAGCCTCTCTAGG - Intergenic
1011285978 6:85723579-85723601 GAGTACCCATTGGAGTCCCATGG + Intergenic
1014708855 6:124782514-124782536 GTGTTCCCATTGTCATCACTGGG + Intronic
1014768098 6:125430404-125430426 GAGTGCCCATCGGCCTCCCAAGG + Intergenic
1015635399 6:135269623-135269645 GTGTCCCCATGGGCCTCTCTGGG - Intergenic
1037554766 8:20011549-20011571 AAGTACAGAATGGCCTCACTTGG - Intergenic
1039593088 8:38767261-38767283 GTGTATCCATTGGCCTCAGAAGG + Intronic
1041274667 8:56144414-56144436 GGGCACCCACTGGCTTCACTTGG - Intergenic
1042945882 8:74154062-74154084 CAGTACCCCTTGGCATCCCTTGG + Intergenic
1045138894 8:99256135-99256157 CTGTACCCATTGGCCTTTCTGGG + Intronic
1046186165 8:110722699-110722721 GAGAACCCATGGGCCACATTTGG + Intergenic
1046674460 8:117093328-117093350 GAGTACACATTCACCTTACTTGG - Intronic
1047980152 8:130172624-130172646 TGGTACCCATTGGCCACACGTGG - Intronic
1048959119 8:139561420-139561442 GGCTACCCAGTGCCCTCACTGGG + Intergenic
1050364671 9:4863244-4863266 AATTACACATTGCCCTCACTGGG + Intronic
1057264328 9:93604003-93604025 GTGTGCCCATTGGCCTCTCCTGG + Intronic
1062426677 9:136509214-136509236 GGGTTCCCACTGGCCTCCCTGGG - Intronic
1187963438 X:24587694-24587716 GAGTGCCCATTGCCATCAATGGG - Intronic
1195140918 X:101958948-101958970 GAGTACACATTAGACTCACCTGG + Intergenic
1197802524 X:130366800-130366822 GGGTACACATTGGAATCACTTGG + Intronic
1198601735 X:138291501-138291523 CAGTTCCCACTGGCTTCACTGGG - Intergenic
1199683572 X:150244314-150244336 GAGTTCCCATTGGTCTCCCTTGG + Intergenic