ID: 1070506952

View in Genome Browser
Species Human (GRCh38)
Location 10:77122099-77122121
Sequence TGCCCTAGGCTGCCCTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070506952_1070506957 -9 Left 1070506952 10:77122099-77122121 CCAGTAAAGGGCAGCCTAGGGCA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1070506957 10:77122113-77122135 CCTAGGGCACAGTGGTGGGAAGG No data
1070506952_1070506959 20 Left 1070506952 10:77122099-77122121 CCAGTAAAGGGCAGCCTAGGGCA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1070506959 10:77122142-77122164 TACTACCTTCTACTTGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070506952 Original CRISPR TGCCCTAGGCTGCCCTTTAC TGG (reversed) Intronic
902273534 1:15323708-15323730 TGCCCTCTGCTGGCCATTACAGG - Intronic
902715592 1:18270449-18270471 TGCCCGAGGCTGCCCTGGAGAGG - Intronic
906678560 1:47709907-47709929 TGCCCTTCGCTGCCCTTCAGCGG + Intergenic
907568640 1:55461741-55461763 TGCCCTAGTCATCCCATTACTGG + Intergenic
908099210 1:60773053-60773075 TGACCTAGCCATCCCTTTACTGG - Intergenic
909835533 1:80249829-80249851 TCCCCTAGCCTGCTCTTCACTGG - Intergenic
911176966 1:94826825-94826847 CCCCGTAGGCTGCCCTTTATGGG - Intronic
911552998 1:99306672-99306694 TGGCGAAGGCTGCCCTTTTCAGG - Exonic
916165284 1:161961275-161961297 TGCTCTAGGCGGCACCTTACAGG - Exonic
916925946 1:169521099-169521121 CTCGCTATGCTGCCCTTTACTGG - Intronic
923113469 1:230912175-230912197 TGCACTTGGCGGCCCTTTCCTGG - Intronic
1067753513 10:48986830-48986852 TGCTCTGGGCTGCCCTTCCCTGG - Intergenic
1069926911 10:71856895-71856917 TGCTCTAGGCTGTCCCTTGCGGG + Intergenic
1070506952 10:77122099-77122121 TGCCCTAGGCTGCCCTTTACTGG - Intronic
1070559651 10:77556540-77556562 TTCCATAGACTGCACTTTACAGG - Intronic
1071891706 10:90015062-90015084 TGACCCAGGCTTCCCATTACTGG + Intergenic
1071904110 10:90153965-90153987 TGACCCAGGCTTCCCATTACTGG - Intergenic
1075090674 10:119442501-119442523 AGCCCAAGGCTGCTCTCTACTGG - Intronic
1075298287 10:121297407-121297429 TGTGGTTGGCTGCCCTTTACAGG + Intergenic
1076546483 10:131248931-131248953 TGCCCTAGGCCGCCCTCGGCAGG + Intronic
1079648909 11:22901880-22901902 TGCCCTAGGCTGCTCTTGGAGGG + Intergenic
1081784387 11:45736528-45736550 TGACCTAGGCTGGCCTCAACTGG + Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1082634765 11:55582807-55582829 TGACCTAGCCTTCCCATTACTGG + Intergenic
1084937661 11:72595677-72595699 CCCCCAAGCCTGCCCTTTACTGG + Intronic
1084940714 11:72611471-72611493 TGCCCTCAACTGTCCTTTACTGG + Intronic
1089824356 11:121260928-121260950 GGTCCTGGGCTTCCCTTTACTGG + Intergenic
1090805803 11:130201397-130201419 AGCCCTCAGCTGCCCTTTGCAGG + Intronic
1093245713 12:16733813-16733835 TGACCTAGGCATCCCATTACCGG - Intergenic
1099937856 12:89149510-89149532 TGACCTAGCCATCCCTTTACTGG + Intergenic
1107373592 13:39778314-39778336 TGCCCTATGCTGCCTTTTCTAGG - Intronic
1115877270 14:37874822-37874844 TGCCCTCTGCTGCCCTCTGCTGG + Intronic
1117341094 14:54792369-54792391 TGTCCTTGGCTGCCTTTTACGGG + Exonic
1120996932 14:90424234-90424256 AGCTCAAGGCTGCCCTTCACAGG + Intergenic
1121318291 14:92975091-92975113 AGCCTTAGGCTGGGCTTTACAGG - Intronic
1122942793 14:104989944-104989966 TGCCCCAGGGTACCCTCTACAGG + Intronic
1124470058 15:29976516-29976538 TGCCCTCGGCAGCCCTCGACAGG + Intergenic
1127565566 15:60184768-60184790 TGACTTAGGCAGCCCTTGACTGG + Intergenic
1129537349 15:76324861-76324883 TGCCCTTGGCTGGCTTTTCCAGG + Intergenic
1133397088 16:5456752-5456774 TGACCAGGGCTGCCCTTCACAGG - Intergenic
1137689022 16:50407498-50407520 TGCCCTGGGCTACCCTCCACTGG + Intergenic
1140476086 16:75239813-75239835 TGCCCCAGGCTCCCCTGTGCTGG - Intronic
1143223148 17:5279348-5279370 TGCACTGGGCTGCCCTATCCTGG + Intergenic
1145410107 17:22652518-22652540 TGCACTAGGCTCCCTTTTAAAGG - Intergenic
1145869245 17:28259926-28259948 TTCCCTAGGCTGCCCTTGGGGGG + Intergenic
1146955094 17:36932756-36932778 TGCCGGATGCTGCCCTTTCCTGG + Intergenic
1147636513 17:41967431-41967453 TGCCCTGTGCTGCCCTGTTCTGG + Intronic
1148078086 17:44951059-44951081 TGGCCTAGGGTGCCCTTGACAGG + Intergenic
1151671816 17:75575046-75575068 TCCCCTGGGCTGCCCTTCCCGGG + Exonic
1152076403 17:78162511-78162533 TCCCCTAGGCTGTCTTTTCCTGG - Intronic
1153312238 18:3688366-3688388 TGCCCTCTGCTTCCCTTTAGAGG - Intronic
1155678663 18:28462506-28462528 TGCCCTACTCATCCCTTTACTGG - Intergenic
1158321746 18:56270802-56270824 TCCCCTAGCCTTCCCTTTCCTGG - Intergenic
1161010005 19:1955425-1955447 TCCACTGGGCTGCCCTTCACCGG + Intronic
1162847472 19:13404539-13404561 TGGCCCAGGCTGCCCTGAACAGG + Intronic
1164523247 19:28994952-28994974 TGCCCTACACTGCCCTTCAGAGG - Intergenic
925195265 2:1918132-1918154 TGCCCTAATTTGCCCTTGACTGG - Intronic
926171824 2:10557615-10557637 TCCCTTAGGCTGCCCTTGCCAGG + Intergenic
932904883 2:75738844-75738866 TCCCATAGGCTGCCCTTGGCAGG + Intergenic
935179810 2:100679410-100679432 TGCCCTAGGCCTCCCATTACAGG - Intergenic
938239628 2:129733305-129733327 TGCCCTAGGATGCACTTTGTGGG - Intergenic
940527076 2:154829644-154829666 TGACCTAGCCATCCCTTTACTGG - Intronic
941047552 2:160693780-160693802 GGTCCTAGGCTTTCCTTTACTGG + Intergenic
941283315 2:163579702-163579724 TGCCCTAGAATGCCCTGTATTGG - Intergenic
942522785 2:176821596-176821618 TGCCATTGGCTGCCATTTCCTGG + Intergenic
944194049 2:197033501-197033523 TTCCCTAGTCTGTCCTTTACTGG - Intronic
945341232 2:208657654-208657676 TGCCCTACACTGCCCTCTAAGGG - Intronic
948001439 2:234571027-234571049 TGCTCTAGGCTACCCTGGACAGG + Intergenic
1170850368 20:19998823-19998845 TGCCCTAGGCAGCCCCTCCCTGG - Intronic
1171575012 20:26301595-26301617 TGACCCAGCCTTCCCTTTACTGG - Intergenic
1175519510 20:59591179-59591201 AGCCCCAGCCTGCCCTTGACAGG + Intronic
1177057523 21:16326412-16326434 TGCCTCGGGCTGCCCTTTCCCGG - Intergenic
1179077448 21:38136244-38136266 TGCCCTAGGCAAACCTTTAGAGG + Intronic
1180967677 22:19799033-19799055 TGCCAGAGGCTTCCCTTTAGAGG - Intronic
1180982652 22:19886169-19886191 TGCCCTCGGCTGCCCTCCTCAGG - Intronic
1181932891 22:26417118-26417140 TGCCCCAGGCAGCTTTTTACAGG + Intergenic
1182024450 22:27107043-27107065 TTCCCAAGGCTTCCCTTGACAGG + Intergenic
1183040097 22:35171526-35171548 TGCCCTTGACTGCCCTGTCCTGG - Intergenic
1184229862 22:43152549-43152571 TGCCTCAGGCTGCCCTGTCCCGG - Intronic
1185236819 22:49718709-49718731 TGGCCTAGGATGTCCTTGACTGG + Intergenic
950081453 3:10225087-10225109 TGCCCTCTGCTGCCCTTTTCTGG + Intronic
950953821 3:17029620-17029642 TACCCAAGGCTTCCCTTTTCTGG - Intronic
951627364 3:24680671-24680693 TGCCCTTTGCTGCCCTCTGCTGG - Intergenic
954275519 3:49539518-49539540 TGCCCTAGGCTGTCCTTAGGAGG - Intergenic
957948328 3:87092763-87092785 TGCCCCAGGCATCCCATTACTGG - Intergenic
959461371 3:106629807-106629829 TGCCCTAGGTGGCTCTTGACAGG + Intergenic
963607356 3:147422496-147422518 TGTCCTTCGCTGCCCTTTTCAGG - Intronic
967983160 3:195077624-195077646 AGCCCCAGGCCGCGCTTTACAGG - Intronic
970132688 4:12888624-12888646 TGCCCTAGGCTGAGCTTCTCTGG + Intergenic
977249248 4:94671025-94671047 AGCCCCAGGCTGTCCTTTAGAGG - Intergenic
984146512 4:176067704-176067726 AGCCCTAGTCTCCCCTCTACTGG - Intronic
985890440 5:2711480-2711502 TGCTCTAGGCTGTCCTTTCTGGG + Intergenic
995133868 5:108659722-108659744 TGTTCGAGGCTGCCCTTTCCTGG + Intergenic
998909173 5:146939570-146939592 TGGCCTAGGCTCCACTTTAAGGG + Intronic
1000038747 5:157468991-157469013 TGCCCTAGCATCCCCTTGACTGG + Intronic
1000583918 5:163071192-163071214 GGTCCTAGGCTTTCCTTTACTGG + Intergenic
1003868062 6:10381464-10381486 TGCCGCAGGCTGCCCTTAGCCGG - Intergenic
1007283228 6:40728125-40728147 TGCCCTAGGCTTCCCTCTTTGGG - Intergenic
1007819496 6:44550584-44550606 TGCCCCAGGCTGCCCTTTTGTGG + Intergenic
1007921870 6:45617557-45617579 GGCCCTAGGCTTCCCTCTCCTGG + Intronic
1008666954 6:53725993-53726015 TGCCCTGCGCTGCCCTCTAGCGG + Intergenic
1017519125 6:155186219-155186241 GGTCCTGGGCTGCCCTATACTGG + Intronic
1018939310 6:168297848-168297870 TGCCCCGTGCTGCCCTTGACTGG - Intronic
1023635894 7:42209932-42209954 TGCCAGAGGCTCTCCTTTACAGG - Intronic
1025578014 7:62672470-62672492 TGACCTAGCCTTCCCATTACTGG + Intergenic
1032436835 7:131907649-131907671 TGCCATAGGATGCCCCTTTCTGG - Intergenic
1034391545 7:150791475-150791497 GGCCCTGGGCTGCCCTAGACAGG + Exonic
1040907108 8:52480329-52480351 TGCCCGAGGCAGCCCTTCCCTGG + Intergenic
1048233645 8:132668785-132668807 TGGCCTAAGGTGCCCTTTCCTGG - Intronic
1049616753 8:143578852-143578874 TGCCCCACGCCGCCCTTTCCTGG - Intergenic
1050676000 9:8053681-8053703 TGCCCTGGACTGCCCCTGACCGG - Intergenic
1051983516 9:23053856-23053878 TGTCCTAGGCTTCCCTTTTTTGG + Intergenic
1052111660 9:24592634-24592656 TGCCCTAGGCTCCAGTTTATTGG + Intergenic
1059768530 9:117406308-117406330 TTCCCTACGCTGCTCTGTACAGG - Intronic
1203683349 Un_KI270757v1:8832-8854 TGACCTAGCCAGCCCATTACTGG + Intergenic
1187847996 X:23561168-23561190 TGACCTAGGCATCCCATTACTGG - Intergenic
1188135964 X:26495377-26495399 TGTTCTTGGCTGACCTTTACTGG - Intergenic
1188814134 X:34690236-34690258 AGTCCTGGGCTTCCCTTTACTGG + Intergenic
1191935045 X:66418299-66418321 TGACCCAGGCATCCCTTTACTGG - Intergenic
1192943649 X:75940380-75940402 TGACCTAGCATTCCCTTTACTGG - Intergenic
1199830067 X:151540345-151540367 TGCCCTAGGCACCCCTTTCCTGG + Intergenic
1200233825 X:154458834-154458856 TGCCCGAGGTTGCCACTTACAGG + Intronic