ID: 1070510555

View in Genome Browser
Species Human (GRCh38)
Location 10:77156956-77156978
Sequence CAGTCTCCCCAAAGGCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 4, 2: 27, 3: 49, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070510555_1070510559 5 Left 1070510555 10:77156956-77156978 CCTCCTAGCCTTTGGGGAGACTG 0: 1
1: 4
2: 27
3: 49
4: 250
Right 1070510559 10:77156984-77157006 AAGGATAACCCTAGTCCTCCAGG No data
1070510555_1070510561 9 Left 1070510555 10:77156956-77156978 CCTCCTAGCCTTTGGGGAGACTG 0: 1
1: 4
2: 27
3: 49
4: 250
Right 1070510561 10:77156988-77157010 ATAACCCTAGTCCTCCAGGGTGG No data
1070510555_1070510560 6 Left 1070510555 10:77156956-77156978 CCTCCTAGCCTTTGGGGAGACTG 0: 1
1: 4
2: 27
3: 49
4: 250
Right 1070510560 10:77156985-77157007 AGGATAACCCTAGTCCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070510555 Original CRISPR CAGTCTCCCCAAAGGCTAGG AGG (reversed) Intronic
900506611 1:3032530-3032552 GAGTCACCCCAAAGCCTTGGAGG - Intergenic
900659333 1:3774887-3774909 CAGCCTCCCCAGAGGCCAGAAGG + Intronic
900682393 1:3924179-3924201 CAGACTCCTCCCAGGCTAGGGGG - Intergenic
904175212 1:28622906-28622928 CAGTCTCCCCAGTAGCTGGGAGG - Intronic
906427723 1:45726977-45726999 CAGCCTCCCAAAGTGCTAGGAGG + Intronic
906822507 1:48944226-48944248 CAGTCTTCCCAGGGGTTAGGTGG + Intronic
907443277 1:54491199-54491221 CAGTCTCCCCAAAGCCGGGCAGG - Intergenic
909027591 1:70501177-70501199 CAGCCTCCCAAAGTGCTAGGTGG + Intergenic
913042256 1:115038663-115038685 CACTCTCCCCAAAGGTGAGCGGG + Intergenic
915377353 1:155408759-155408781 CAGCCTCCCAAAGTGCTAGGAGG - Intronic
916895964 1:169162162-169162184 CAGTCTCCCCAAAGGATCAAAGG - Intronic
918703862 1:187637638-187637660 CAGTCTCCCCACTGACTGGGCGG + Intergenic
920118185 1:203636079-203636101 CTGTCTCCTCAAAAGTTAGGTGG - Intronic
923332137 1:232935065-232935087 CAGCCTTCCCAATGTCTAGGCGG - Intergenic
923467020 1:234258122-234258144 CAGCCTCCCCGAAAGCTTGGAGG + Intronic
923779453 1:237009160-237009182 CAGTCTCCCCAAAGGCCTGGAGG - Intergenic
923884543 1:238140106-238140128 CAGTCTCCTCGAAGGCTCAGAGG - Intergenic
924113831 1:240726341-240726363 CAGTCTCCCTGAAGCCTTGGAGG - Intergenic
1062942872 10:1438034-1438056 CACTCTGCCCAAAGGAGAGGAGG - Intronic
1063155031 10:3371573-3371595 CAGTCTCCTCAAAGGCTTGAAGG + Intergenic
1064858476 10:19797923-19797945 CAGTCTCCCCAAAGGCTTAGAGG - Intergenic
1065207887 10:23374511-23374533 GAGTCTCCCCAAATGCTTGGGGG + Intergenic
1066151794 10:32629609-32629631 AAGTCTCCCCCACTGCTAGGAGG - Intronic
1066267937 10:33794536-33794558 CAGTCTTCCTAAAGGCTCAGAGG + Intergenic
1067234277 10:44435276-44435298 CAGTGTCCCCAAAGCATAGATGG + Intergenic
1068037658 10:51781379-51781401 CTGTTTCCCCAAAGGCAAGAGGG + Intronic
1068149944 10:53118908-53118930 CAATCTCCCTGAAGGCTCGGAGG - Intergenic
1068192279 10:53667442-53667464 CAGTCTCCACAAAGACAGGGTGG - Intergenic
1068981849 10:63070974-63070996 CATACTCTCCAAAGGCTAGAGGG - Intergenic
1068986102 10:63108942-63108964 TAGTCTCCCCAAAGGCTCAGAGG - Intergenic
1069177622 10:65312919-65312941 CAGTCTCCCCAAAGGCTCAGAGG - Intergenic
1069401280 10:68049655-68049677 CAGCCTCCCAAAGTGCTAGGTGG - Intronic
1069934991 10:71909289-71909311 CAGTGTCCCCAAAGGCTCAGAGG + Intergenic
1070510555 10:77156956-77156978 CAGTCTCCCCAAAGGCTAGGAGG - Intronic
1070573122 10:77656602-77656624 CAGCCTCCCCAATGGCTGGCAGG + Intergenic
1071271418 10:84010971-84010993 CACTCTCTCCAATGACTAGGAGG + Intergenic
1071299489 10:84245536-84245558 CAGTCCCCCAAAAGGCTCTGGGG + Intronic
1072275672 10:93820437-93820459 CAGTCTCCCCAAAGGCTCACGGG + Intergenic
1073248408 10:102107371-102107393 CAGTCACCCCAGAGGAAAGGGGG + Intergenic
1073460512 10:103663121-103663143 CAATCTCCTTGAAGGCTAGGGGG + Intronic
1077337645 11:2012568-2012590 CAGTCACGCCACAGGCCAGGTGG - Intergenic
1079108650 11:17590783-17590805 CAGTCTCTCCAAAGTCTGTGGGG - Intronic
1083709860 11:64541272-64541294 CAGTCTCCCAAAAGGCTCTGGGG + Intergenic
1084046391 11:66570496-66570518 CAGTCTCACTGAAGGCTTGGAGG - Intergenic
1084122434 11:67077512-67077534 CAGTCTGAGCGAAGGCTAGGAGG - Intergenic
1084233851 11:67773382-67773404 CAGCCTCCCCATTGGCTTGGTGG + Intergenic
1084371528 11:68748092-68748114 GGGGCTCCCCAAAGGCCAGGAGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1086304397 11:85464349-85464371 CAGTTTCCCTGAAGGCTTGGAGG + Intronic
1086881932 11:92159830-92159852 CAATCTCCCCAAAGGCTCCGAGG + Intergenic
1089576130 11:119445445-119445467 CAGTCTCACCAAAGTCACGGAGG - Intergenic
1089956539 11:122576545-122576567 CAGTTTTCCCAAAGACTTGGAGG + Intergenic
1091077953 11:132638835-132638857 CAGTCTTCCTAAAGGCTTAGAGG - Intronic
1202820629 11_KI270721v1_random:67750-67772 CAGTCACGCCACAGGCCAGGTGG - Intergenic
1094024740 12:25950771-25950793 CAGTCTCCATGAAGGCTGGGAGG + Intergenic
1095164727 12:38958425-38958447 CAGCCTCCCAAAGTGCTAGGAGG + Intergenic
1095492203 12:42746474-42746496 CAGTCTCCCCGAAGGCTTGGAGG - Intergenic
1095918475 12:47504693-47504715 CACTTTCCCCAGAGGCCAGGTGG - Intergenic
1096551010 12:52371605-52371627 CCATCTCCCCAAATCCTAGGAGG + Intergenic
1097136088 12:56857043-56857065 CAGTCTTCCGAAAGGCTCAGAGG + Intergenic
1097973100 12:65656163-65656185 AACTCTGCCCAAAGGTTAGGAGG - Intergenic
1098291947 12:68964817-68964839 CAGTCTTCCTGAAGGCTTGGAGG - Intronic
1099809872 12:87567577-87567599 TAGTCTCCCAGAAGGCTTGGAGG + Intergenic
1100426747 12:94494629-94494651 CAGTCTCCCTAAAGGTTCAGAGG - Intergenic
1101138427 12:101770020-101770042 CAGTCACTCCAAAGGCCAGAAGG - Exonic
1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG + Intergenic
1103139623 12:118537173-118537195 CAGCCTACACAAAGGCTAAGAGG + Intergenic
1104237459 12:126952938-126952960 CATTCTCCCCAAAGGCTCAGAGG + Intergenic
1104340928 12:127947666-127947688 CAGTCTCCCCGAAGGCTTGGAGG - Intergenic
1105206411 13:18229539-18229561 GAGACTCCTCAGAGGCTAGGAGG - Intergenic
1107044914 13:35983963-35983985 CAGTTTCCCCATAGTCAAGGAGG - Intronic
1107288516 13:38824507-38824529 CAGTCTCACCAAAGGCTCATAGG + Intronic
1108846047 13:54679326-54679348 CAATCTCACCAAAGGCTCAGAGG - Intergenic
1109343055 13:61086221-61086243 CATTCTCCCCTGAGGCTAGCTGG + Intergenic
1112632687 13:101179850-101179872 CACTCTCTCCAAAGGCCACGGGG + Intronic
1113918543 13:113889738-113889760 CAGTCTCTCCAAAGGCTTAGAGG - Intergenic
1115816294 14:37167905-37167927 CAGTCTCCCCAAGCATTAGGGGG - Intronic
1115992468 14:39164235-39164257 CGGCCTCCCAAAATGCTAGGAGG - Intronic
1116117237 14:40670247-40670269 CAGTCTCCCTGAAGGCTCAGAGG - Intergenic
1118886229 14:69868281-69868303 CAGTCTCCCCAAAGACTTGGAGG - Intronic
1119048707 14:71344817-71344839 CAGTCTCCCAAACTGCTAGGAGG + Intronic
1120521414 14:85531343-85531365 AAGTCTCTCCACAGGCTTGGGGG + Intronic
1121387873 14:93545848-93545870 CAGTCTCATCAAAGGCTTGTAGG + Intronic
1121658236 14:95614378-95614400 CAGTCTCCCCGAAGTCTCAGAGG + Intergenic
1121836965 14:97101140-97101162 CAGCCTCTCCTAAGGCCAGGAGG + Intergenic
1122307569 14:100775641-100775663 CAGGCTCCTCAAAGCCCAGGAGG - Intergenic
1122482814 14:102058509-102058531 CAATCTCACCAAAGGCTCGGAGG - Intergenic
1124335873 15:28856702-28856724 CAGCCTCCCCAAAGGCTCAGAGG - Intergenic
1126140277 15:45431848-45431870 CAGTTCCCCTAAAGGGTAGGAGG - Intronic
1126675475 15:51156552-51156574 CTGTCTCCCCAAAGGAGAAGAGG - Intergenic
1127182012 15:56430905-56430927 CAGCCTCCCCAAGTGCTGGGTGG - Intronic
1127296024 15:57609162-57609184 CTCTCTTCCCAAAGCCTAGGTGG + Intronic
1128479268 15:68023279-68023301 CAGTCTCCCTGAAGACTTGGAGG + Intergenic
1129329826 15:74821299-74821321 TAGTCTCCCCTAAGGCCTGGAGG + Intronic
1129614944 15:77091008-77091030 CACTTTCCCCAAAGGCCAGATGG - Intergenic
1129801641 15:78419358-78419380 CAGTCTCCCTGAAGGCTCAGAGG + Intergenic
1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG + Intronic
1132457869 16:34022-34044 CAGGCTCCCCAGAGACAAGGTGG - Intergenic
1132590946 16:726238-726260 CCGTTCCCCCAAAGGCCAGGAGG - Intronic
1132742859 16:1424192-1424214 CAGTCTCCCCAAAGGCGCCAAGG - Intergenic
1132991200 16:2795712-2795734 CAGCCTCCCCAAAGGCTTGGAGG + Intergenic
1133744264 16:8675018-8675040 CAGTCTCCCAAGAGGTGAGGGGG - Intronic
1134638343 16:15809571-15809593 CAGACTGCCCAGAGGCTGGGAGG + Intronic
1135125441 16:19805815-19805837 CAATATCCCCAAAGGCTCGGAGG + Intronic
1135356258 16:21771721-21771743 CAGTCTCCCCAAAAACTTGGAGG + Intergenic
1135454749 16:22587860-22587882 CAGTCTCCCCAAAAACTTGGAGG + Intergenic
1135602544 16:23795695-23795717 CATTCTCTCCAAAGGCTCGGAGG - Intergenic
1135660769 16:24294507-24294529 CACACTCCACAAAGTCTAGGTGG + Intronic
1136487941 16:30585330-30585352 CGGTGTCCCCAGAGGCTAGTGGG - Intronic
1138649105 16:58447967-58447989 CTGTCTCCCCCTAGACTAGGAGG + Intergenic
1138731600 16:59201408-59201430 CAATCTCCCTGAAGGCTTGGAGG + Intergenic
1139105583 16:63823163-63823185 CAATCTCGCCAAAGGTTTGGAGG - Intergenic
1139106367 16:63831407-63831429 CATTCTCCCTGAAGGCTTGGAGG - Intergenic
1142228619 16:88889104-88889126 CTGTGTCCCCAAAGACTGGGAGG + Intronic
1143801890 17:9390055-9390077 CTGTGTCCCCAAAGCCTGGGTGG - Intronic
1146146836 17:30426351-30426373 CAGTCTCCCTGAAGGCTCAGAGG + Intronic
1146534414 17:33637858-33637880 AAGTCTCCCCAGAGGCTGAGAGG + Intronic
1147660185 17:42113179-42113201 CAGTCTCCCCCAGGGGTGGGGGG - Exonic
1151273523 17:73015266-73015288 CAGTATTCCCAAAGGCAGGGAGG - Intronic
1152961868 18:84725-84747 CAGGCTCCCCAGAGACAAGGTGG - Intergenic
1153249599 18:3108142-3108164 CAGTCTCCCTGAAGGCTCAGAGG - Intronic
1153993539 18:10420639-10420661 CAGTCTCTCTGAAGGCTTGGAGG + Intergenic
1154241924 18:12660040-12660062 CAGTATCCCATAAGGCCAGGAGG - Intronic
1155921152 18:31603991-31604013 CAGTCTCCCCAAAGACTTGGAGG - Intergenic
1156409887 18:36817552-36817574 CAGCCTCCCCAATAGCTGGGAGG + Intronic
1156817121 18:41324984-41325006 CAGCCTACCCAAAGGCTTGGAGG + Intergenic
1157576067 18:48744346-48744368 CAATCTCAACAAAGGCTTGGTGG - Intronic
1159490860 18:69132755-69132777 CAGCCTCCCCAAAAGCTCAGAGG + Intergenic
1159775637 18:72600738-72600760 CAGTCTCCCCAAAGGCTTGGAGG + Intronic
1161637209 19:5396437-5396459 CAGTATAAGCAAAGGCTAGGAGG + Intergenic
1162033618 19:7927671-7927693 CAGGAACCCCAAAGGCGAGGTGG - Exonic
1163002007 19:14374349-14374371 CAGTCTCCCAAAGTGCTGGGAGG + Intergenic
1164063012 19:21691618-21691640 AAGTTTCCCCAAAGGCTTGGGGG + Intergenic
1165060720 19:33204094-33204116 CAGTTTCCCCAAGGGCCAGGTGG + Intronic
1165192195 19:34074300-34074322 CAGTCTCCCCGAAGGCTCGGGGG - Intergenic
1168311146 19:55461445-55461467 CAGTTTCCCCATCTGCTAGGCGG + Intronic
1168726608 19:58586338-58586360 CAGGCTCCCCAGAGACAAGGTGG + Intergenic
927098212 2:19764228-19764250 CAAAATCCCCAAAGGCTAGAGGG - Intergenic
927501217 2:23584559-23584581 CAATGTCGCCAAAGGCTTGGAGG - Intronic
928020049 2:27697345-27697367 CAGCCTCCCAAAGTGCTAGGAGG + Intergenic
928675655 2:33648424-33648446 TAGTCTCCCCAAAGGCTTGAAGG - Intergenic
928931114 2:36625438-36625460 CAGTCTCCCCAAGGGCTGAAAGG + Intronic
931412332 2:62045087-62045109 CAGTCTCCCCAAAGGCCTGCAGG + Intronic
931441181 2:62291791-62291813 CAGTCTCCCTGAGGGCTTGGAGG - Intergenic
934559391 2:95304810-95304832 CTGGCTCCCCACAGGCCAGGAGG + Intronic
937583951 2:123523768-123523790 CAGTCTCCTCAAAGGCTCAGTGG + Intergenic
939042590 2:137208613-137208635 CAGTCTCCTCAAAGGCTCAGAGG + Intronic
939090952 2:137779820-137779842 CAGTCTCCTCCAAGGCTTAGAGG - Intergenic
939414890 2:141882963-141882985 CAGTCTCACCAAAGGCATTGCGG + Intronic
939418153 2:141928075-141928097 CATTCTCCCCAAAGTGTAGTGGG + Intronic
944314112 2:198267130-198267152 CAGTCTCCCCAGAGGCTTGAAGG + Intronic
946053467 2:216882427-216882449 CTCTCTCCCCACAGTCTAGGGGG - Intergenic
946245107 2:218382965-218382987 AAGGGTCCCCAAAGGCTAAGCGG + Exonic
946760149 2:222985498-222985520 CAGTCTTCCCAAAGGCTTGGAGG + Intergenic
946966409 2:225042167-225042189 CAGCTTCCCCAAAAGCTCGGCGG - Intronic
947215689 2:227747930-227747952 CAGTCTCCCAAAGTGCTGGGAGG + Intergenic
947498174 2:230653991-230654013 GAGCCTCCCCAAAGGCAAGGGGG + Intergenic
947593916 2:231399352-231399374 CAGTCTCCCCAGAGGCCGGGCGG + Exonic
948309507 2:236974519-236974541 CAGTCTCCATGAAGGCTTGGAGG - Intergenic
1168781863 20:499189-499211 CATCATCCCCAAAGGCTATGTGG + Intronic
1168809419 20:694521-694543 CAGCCTCCCATCAGGCTAGGTGG - Intergenic
1170391643 20:15881309-15881331 CAGTCTCCCAAAAAGCTTGGAGG + Intronic
1170435974 20:16329145-16329167 CAGTCATCCAAAAAGCTAGGGGG + Intronic
1171129014 20:22631002-22631024 CAGTCACCCCCAAAGCTGGGAGG - Intergenic
1172617972 20:36301723-36301745 CTGTCTCCCTGAAGGCTCGGAGG + Intergenic
1173591909 20:44231433-44231455 CAGCCTCCCCAAAGGCAGGGAGG - Intergenic
1173684603 20:44914134-44914156 CAGACACTCCAAAGGCTACGGGG - Intronic
1176910690 21:14561312-14561334 CAGGCTCCCCAAAGGCTTGGAGG - Intronic
1177316709 21:19471621-19471643 CAGTTTCCCACAATGCTAGGTGG + Intergenic
1177816423 21:25982258-25982280 CAGTCTCCCCACAGGCCTGCTGG - Intronic
1178420552 21:32439590-32439612 CAGCCTCCCCATTGGCTCGGTGG - Intronic
1178863368 21:36307681-36307703 CAGTCTCCCCAAAAGTTGTGAGG - Intergenic
1179668866 21:42931490-42931512 CAGTCTCCCCAGAGGCTTGCAGG - Intergenic
1180005010 21:45016595-45016617 CAGTCACCCCAAAACCTAGCTGG - Intergenic
1180655706 22:17418972-17418994 CAGTGTCCCCTGAGGCGAGGCGG - Intronic
1180759542 22:18189169-18189191 GAGACTCCTCAGAGGCTAGGAGG + Intergenic
1180769852 22:18373469-18373491 GAGACTCCTCAGAGGCTAGGAGG + Intergenic
1180776477 22:18489197-18489219 GAGACTCCTCAGAGGCTAGGAGG - Exonic
1180809204 22:18746566-18746588 GAGACTCCTCAGAGGCTAGGAGG - Intergenic
1180827794 22:18876425-18876447 GAGACTCCTCAGAGGCTAGGAGG + Intergenic
1181195196 22:21180488-21180510 GAGACTCCTCAGAGGCTAGGAGG - Intergenic
1181214250 22:21312286-21312308 GAGACTCCTCAGAGGCTAGGAGG + Intergenic
1181524701 22:23473924-23473946 GAGGCTCCTCAGAGGCTAGGAGG + Intergenic
1182383325 22:29912527-29912549 CAGCCTCCCAAAGTGCTAGGAGG + Intronic
1185330238 22:50249096-50249118 CAGTCACCTCAAAGGCCAGTGGG + Exonic
1203231682 22_KI270731v1_random:114653-114675 GAGACTCCTCAGAGGCTAGGAGG + Intergenic
1203277890 22_KI270734v1_random:102422-102444 GAGACTCCTCAGAGGCTAGGAGG + Intergenic
950119056 3:10469834-10469856 CCCTCTCCCCAAAGGCTGGAGGG - Intronic
950211236 3:11125109-11125131 CAGTTTCCCAAAAGGCCAGGTGG - Intergenic
950626466 3:14251120-14251142 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
952494480 3:33903777-33903799 CAGCCTCCCCAAAAGCAATGGGG - Intergenic
952619602 3:35322030-35322052 CAATCTCCCCAAAGGCTCAGAGG + Intergenic
953177945 3:40568785-40568807 CAATCTCTCCAAAGGCTCAGGGG + Intronic
953746486 3:45577954-45577976 CAGTGTCCCTGAAGGCTTGGAGG - Intronic
953990471 3:47479347-47479369 CAGTCTCCCCAAAGGCTTAGAGG + Intergenic
954685671 3:52368942-52368964 CACTCTCCTCCAAGGCTGGGTGG + Intronic
954815414 3:53276623-53276645 CAGCCTCCCCAGTAGCTAGGGGG - Intergenic
955536756 3:59931707-59931729 GAGTCTCCACAAATTCTAGGAGG - Intronic
959151892 3:102617961-102617983 CAGTTTTCCCAAAGGCTCAGAGG + Intergenic
960842536 3:121974907-121974929 CAGTCTCCCCAAAGACTTGGAGG + Intergenic
961704756 3:128775263-128775285 CAGTCTCACTAAAAGCCAGGTGG - Intronic
962721381 3:138178180-138178202 CAGCCTCCCCAATAGCTGGGAGG - Intergenic
962977971 3:140462953-140462975 CAGCCTCCCCCATGGGTAGGTGG - Intronic
963644820 3:147900880-147900902 CTGTCTCCCTGAAGGCTTGGAGG + Intergenic
964098873 3:152964899-152964921 CAGTCTCCCCAGAGGCTCAAAGG + Intergenic
965807762 3:172559597-172559619 CAGCCTCCCAAAATGCTGGGGGG - Intergenic
968516738 4:1018721-1018743 CAGTTTCCCCATAGGCTGCGTGG + Intronic
969821300 4:9722377-9722399 CAGCCTCCCCATTGGCTCGGTGG - Intergenic
970237548 4:13973788-13973810 CAGTCTCCCTGAAGGCTCAGAGG - Intergenic
971659229 4:29390289-29390311 CAATCTCCCCAAAGACTTGGAGG - Intergenic
971846846 4:31929314-31929336 CAGTCTCACCAAAGGCTTGCAGG - Intergenic
972302027 4:37793406-37793428 CAGTCTTCCCAAAGGCACAGAGG + Intergenic
972305157 4:37823797-37823819 CAGTTTCCCCAAATGTTAGGTGG - Intergenic
974415959 4:61607071-61607093 CAGTCTCCCCAAAGACTCAGAGG + Intronic
975204641 4:71630831-71630853 CAGTATCCCTGAAGGCTTGGAGG + Intergenic
976164508 4:82240021-82240043 CAGTCACCCCAAGGGCCAGAGGG + Intergenic
977014873 4:91679449-91679471 GAGTCTCCTCAAAGGTTAGAGGG + Intergenic
977761117 4:100738493-100738515 CACTCTCCCCAAAGGCAGGTTGG - Intronic
977847299 4:101780987-101781009 CACTCAACCCAAAGGCAAGGGGG - Intronic
978546286 4:109875550-109875572 CAGTCTCACCAATGGATAGGGGG - Intergenic
978713752 4:111816876-111816898 CAGTCTCTCTAAAGGCTGGCAGG - Intergenic
979919040 4:126476058-126476080 CAATCGTCCCAAAGGCTTGGAGG - Intergenic
980717596 4:136647403-136647425 CATTCACCCCAAAAGGTAGGAGG - Intergenic
980745471 4:137007364-137007386 CACCCTCCCCAGAGGCCAGGAGG - Intergenic
980819426 4:137994387-137994409 CAGTCTCCCCAAAGGCTTGGAGG + Intergenic
980829178 4:138108851-138108873 CAATCTCCCCAAAGGCTTGGAGG - Intergenic
981463796 4:145042010-145042032 CAGTCTCCCCAAAGGTTTATTGG - Intronic
981740012 4:147991582-147991604 CAGGCTCCCAGAAGGCGAGGAGG + Intronic
984245214 4:177267593-177267615 CAGTCTCCCCGAGGGTTCGGGGG + Intergenic
985958887 5:3284586-3284608 CAGGCTCGCCAATGGGTAGGAGG + Intergenic
986241559 5:5964696-5964718 CAGTCTCTCCAAAGGTTCGGAGG - Intergenic
987857393 5:23438382-23438404 CAGTCTCCTCAAAGGCTCAGAGG - Intergenic
988866930 5:35345538-35345560 CAGTCTCCCTGAAGGCTTGGAGG + Intergenic
991191629 5:63880770-63880792 CAGCCTCCCAAAATGCTGGGTGG - Intergenic
991410335 5:66339326-66339348 CAGTCTCCCTGAAGGCTCTGAGG + Intergenic
991609993 5:68440155-68440177 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
991950516 5:71943126-71943148 CAGTCTCTACAAAGGTCAGGTGG + Intergenic
992688899 5:79224207-79224229 CAGTCTCCCCAAAGGCTTTCAGG + Intronic
992959154 5:81941095-81941117 CAGTCTCCCTAAAGTCTTGGGGG - Intergenic
997469819 5:134111106-134111128 CAGTCTCCCCATAGGTTAAATGG - Intergenic
998600435 5:143579724-143579746 CAGTCTCCCCAAGGTCTAGGGGG + Intergenic
999916249 5:156265259-156265281 CTCCCTCCCCAAAGACTAGGGGG - Intronic
999976063 5:156913257-156913279 CAATCTCCCCAAAGGCTTGAAGG - Intergenic
1000017800 5:157293807-157293829 CAGTCTCCCCAAAGGCTTGGAGG + Intronic
1000201091 5:159011872-159011894 AAGGCTCCACAAAGGCTATGTGG - Intronic
1000847942 5:166304806-166304828 CAGTCACCGCAAAGGCTCAGAGG + Intergenic
1001285311 5:170418744-170418766 CAGTGTGAACAAAGGCTAGGAGG - Intronic
1002467860 5:179416711-179416733 GAGCCTCCCCACAGGCTCGGAGG + Intergenic
1003049716 6:2768173-2768195 CAGTCATCTCAAATGCTAGGTGG + Intronic
1006117243 6:31781838-31781860 CAGTCTCCAGCAAGGCAAGGCGG - Exonic
1006354407 6:33546038-33546060 CAGCCTCCCAAGAGGCTAAGAGG - Intergenic
1006870092 6:37243566-37243588 CAATCTCCCCAAAGGCTCAGAGG + Intronic
1007210031 6:40186131-40186153 CAGTCTCCACAAAGTCTCAGAGG + Intergenic
1009717491 6:67417987-67418009 CAGTTCCCCCAAAGCCTATGTGG + Intergenic
1010729914 6:79380197-79380219 CAATTTCCTCAAAGGCTTGGAGG - Intergenic
1011491978 6:87901638-87901660 CAGTCTCCCCTAAAACTTGGGGG + Intergenic
1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG + Intergenic
1014629331 6:123770263-123770285 CAGTCTTCCCAAAAGCTCAGAGG + Intergenic
1017307179 6:152932231-152932253 CAGTCTGTCCAAAGGCTACATGG - Intergenic
1017578779 6:155837009-155837031 CAGTCTCCCAACATGCTGGGAGG - Intergenic
1017598231 6:156053220-156053242 CAGTCTCCCCTAAGTCTCTGGGG - Intergenic
1018345349 6:162893362-162893384 CAGTCTCTCCAAAGCCGAGAAGG + Intronic
1021528401 7:21615509-21615531 CAATCTCCCCAAAGGATTTGAGG - Intronic
1021575490 7:22102229-22102251 CAGTCATCACAAAAGCTAGGTGG - Intergenic
1022096890 7:27146823-27146845 GTGTCTCCCCAAAGCCTTGGAGG - Intronic
1022438349 7:30411353-30411375 AGTTCTCCCCAAAGGCCAGGTGG + Intronic
1022977730 7:35574568-35574590 CAGCCTCCCCCATGGGTAGGTGG + Intergenic
1023594151 7:41811080-41811102 CGGCCTCCCGAAATGCTAGGAGG - Intergenic
1024929225 7:54652468-54652490 CAGCCTCCCAAAGTGCTAGGAGG + Intergenic
1026288020 7:68980727-68980749 CAGTCTCCCCAAAAACTCTGGGG - Intergenic
1026972462 7:74476710-74476732 CACTGGCCCCAAAGGCTGGGTGG - Intronic
1027526076 7:79270229-79270251 CAATTTCCCCAAAGGCTCAGAGG - Intronic
1027744968 7:82061702-82061724 CAATCTCATCAAAGGCTCGGAGG + Intronic
1028875602 7:95819711-95819733 CAGTCTCCCCAAAGTCGAATTGG - Intronic
1029196499 7:98809290-98809312 CAGTCTGCCCAACTGCTAAGTGG + Intergenic
1029733133 7:102450760-102450782 CCGTCTCCCCACAGGCTCTGGGG - Exonic
1029923290 7:104288986-104289008 CAGTAAGGCCAAAGGCTAGGTGG - Intergenic
1032240219 7:130154102-130154124 CGGTCTCCCCAAAGGCTCCAGGG - Intergenic
1032246767 7:130219933-130219955 CAGTCTCCACAAAGGCTCGGGGG - Intergenic
1032878093 7:136059229-136059251 CAGTCTCCCCACAGACTTGCTGG - Intergenic
1033513299 7:142082117-142082139 CAGTCTCCCCAAAGCCATAGAGG - Intronic
1034254278 7:149715773-149715795 CCTTCTCCCCAAATGCTTGGGGG - Intronic
1036122292 8:6031604-6031626 CAGTCTCCCATAAGTTTAGGGGG + Intergenic
1039300634 8:36205148-36205170 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
1039433552 8:37544361-37544383 AAGTCTCCTCAAATTCTAGGTGG + Intergenic
1039727376 8:40233279-40233301 CAGCCTCCCCAAAGGCTTGGAGG - Intergenic
1039959546 8:42235690-42235712 CAATCTCCCCAGAGGCTTGGAGG - Intergenic
1040855900 8:51947783-51947805 CAGTCTCCCCAAAGGCTTGGAGG + Intergenic
1041425558 8:57716620-57716642 CAGTCTCTCCAAAGTCTCAGAGG + Intergenic
1042397551 8:68309599-68309621 CGATTTCCCCAAAGGCTTGGAGG - Intronic
1043444188 8:80303481-80303503 CAGTCTCCCTGAAGGCTCAGAGG + Intergenic
1043877864 8:85507050-85507072 CAATCTCACCAAAGGCTCAGAGG + Intergenic
1044573724 8:93746931-93746953 CAGTCACCCCAAAGGCTTGGAGG + Intergenic
1047048613 8:121083262-121083284 CAGTCTTCCCAAAGGCTCAAAGG - Intergenic
1047766326 8:127992855-127992877 CGGTGTCACCAAAGGCCAGGAGG - Intergenic
1047791854 8:128211364-128211386 CAGTCTGTGCAAAGGCAAGGAGG + Intergenic
1048428092 8:134341241-134341263 CAATCTCCCCAATGTCTTGGTGG - Intergenic
1049079129 8:140427965-140427987 CAGTCTCCCCATAGGCAGGGAGG - Intronic
1049321433 8:141998967-141998989 CACTCTCTCCAAAGGCTTGAGGG + Intergenic
1050103144 9:2139274-2139296 CAGTCTCCCCTAAGACTTGTAGG + Intronic
1050165234 9:2758457-2758479 TAGTCTCCCCAAAGGCTCAGAGG + Intronic
1050165726 9:2763077-2763099 CAGTCTCCCCATAAGTTTGGAGG + Intronic
1054792089 9:69265900-69265922 CAGGCTCCCACAAGGATAGGAGG - Intergenic
1054917546 9:70509576-70509598 CAGCCTCCCAAAGGGCTGGGTGG + Intergenic
1055191305 9:73527893-73527915 CAGTCTCCCTGAAGGCTCCGTGG - Intergenic
1055468036 9:76584780-76584802 TAGTCTCTCCAAAGGCTCAGAGG + Intergenic
1055649711 9:78395384-78395406 CAGTCTCCCCAAAGGCTCAGAGG - Intergenic
1055941008 9:81649752-81649774 CTGTCTCCCCAGAGGGGAGGAGG - Intronic
1058496238 9:105562240-105562262 CAGTCTCGCCAAAGACTTGGTGG + Intronic
1059535147 9:115073738-115073760 CAGTCTCCCCACAGGCCAGTGGG - Exonic
1061373473 9:130210955-130210977 CAGCCTCCCAAACAGCTAGGAGG + Intronic
1062720573 9:138041071-138041093 CAGAGTCCCCACAGGTTAGGGGG - Intronic
1062736275 9:138139379-138139401 CAGGCTCCCCAGAGACAAGGTGG + Intergenic
1186147940 X:6644314-6644336 CAGTCTCCCTGAAGGCTTAGAGG - Intergenic
1186181942 X:6982339-6982361 CAATATCCCCGAAGGCTTGGAGG + Intergenic
1186316993 X:8381933-8381955 CAGTCTCGCTGAAGGCTGGGAGG + Intergenic
1186807445 X:13154118-13154140 CAGCTTCCCCAAAAGCTTGGAGG - Intergenic
1187074227 X:15917981-15918003 CAGTCTCCCTAAAGGCTTGGAGG + Intergenic
1187086027 X:16044678-16044700 CAGTCTCCCTGAAGGCTCAGAGG + Intergenic
1187087006 X:16051230-16051252 CAGTCTCCCTGAAGGCTCAGAGG + Intergenic
1188911550 X:35854291-35854313 CAGTCTCCCCAAAGGTTCGGAGG + Intergenic
1190738432 X:53271144-53271166 CAGTGTCCGCAAAGGCCTGGAGG - Intronic
1192783904 X:74319730-74319752 CAGTCTTCCGAAAGGCTCAGAGG + Intergenic
1192804710 X:74498534-74498556 CAGTCTCCCCAAAGGCTCAGAGG - Intronic
1194459356 X:94147445-94147467 CATTCTCCCCAACGACTTGGTGG + Intergenic
1194620039 X:96160159-96160181 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
1194997513 X:100607577-100607599 AAGTCTCCCTAAAAGTTAGGGGG - Intergenic
1195140944 X:101959260-101959282 CATTCTCCCCAAAGGCTCAGAGG + Intergenic
1195902938 X:109817560-109817582 CAGACTACCCCTAGGCTAGGGGG - Intergenic
1200398509 X:156005461-156005483 CAGGCTCCCCAGAGACAAGGTGG + Exonic