ID: 1070513277

View in Genome Browser
Species Human (GRCh38)
Location 10:77180175-77180197
Sequence TGGAAGGGTGCTGCCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070513277_1070513288 25 Left 1070513277 10:77180175-77180197 CCAGAAAAGGCAGCACCCTTCCA 0: 1
1: 0
2: 1
3: 14
4: 163
Right 1070513288 10:77180223-77180245 CTGAAATGCCCCTATTTAATGGG No data
1070513277_1070513287 24 Left 1070513277 10:77180175-77180197 CCAGAAAAGGCAGCACCCTTCCA 0: 1
1: 0
2: 1
3: 14
4: 163
Right 1070513287 10:77180222-77180244 CCTGAAATGCCCCTATTTAATGG No data
1070513277_1070513282 -7 Left 1070513277 10:77180175-77180197 CCAGAAAAGGCAGCACCCTTCCA 0: 1
1: 0
2: 1
3: 14
4: 163
Right 1070513282 10:77180191-77180213 CCTTCCACTTTCCAGGAGAAGGG No data
1070513277_1070513280 -8 Left 1070513277 10:77180175-77180197 CCAGAAAAGGCAGCACCCTTCCA 0: 1
1: 0
2: 1
3: 14
4: 163
Right 1070513280 10:77180190-77180212 CCCTTCCACTTTCCAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070513277 Original CRISPR TGGAAGGGTGCTGCCTTTTC TGG (reversed) Intronic
903639548 1:24848836-24848858 TGGATGGGTGCCGCTTCTTCTGG - Intergenic
903769878 1:25757160-25757182 TTGAGGGGTGCTGCTTTTCCTGG - Intronic
907892674 1:58650353-58650375 GGGATGGGTTCTGCATTTTCTGG - Intergenic
912356218 1:109056109-109056131 TTGAAGGCTGCTGCTTTTCCTGG - Intergenic
914509119 1:148315773-148315795 GGTAAGTGTGCTTCCTTTTCAGG - Intergenic
915699829 1:157781288-157781310 TGGATGGGTTATGACTTTTCAGG + Intergenic
916319067 1:163482065-163482087 TGGGAGGGTGCTGATTTTTAAGG - Intergenic
920284361 1:204868914-204868936 TGGAAAAGGGCTGCCTCTTCCGG + Intronic
920443073 1:205994354-205994376 TGGAAGGGTGGTGACTCTCCAGG + Exonic
1063890314 10:10621834-10621856 TGGAAGGGTGCTTACATTTAAGG - Intergenic
1063950335 10:11216315-11216337 TTGAGAGGTGCTGCCATTTCAGG - Intronic
1065798117 10:29325661-29325683 TGAAATGGTGCTGCCTTTATTGG + Intergenic
1070513277 10:77180175-77180197 TGGAAGGGTGCTGCCTTTTCTGG - Intronic
1074831415 10:117252305-117252327 TGGAAGGGTTCTTCCATTCCAGG - Intronic
1075015710 10:118908739-118908761 TGGACGGGAGCTGGCGTTTCAGG + Intergenic
1076618087 10:131770160-131770182 TGGATGCCTGCTGCCTTTCCAGG - Intergenic
1076698311 10:132257552-132257574 TGGCAGGATGCTGCCTGTTCTGG + Intronic
1076829064 10:132985226-132985248 AGGAAGGGTGGTGCCTTTGGAGG + Intergenic
1077218187 11:1403828-1403850 TGGAAGTGTCCTGGCTTCTCTGG + Intronic
1077304706 11:1863918-1863940 GGGGAGGCTGCTGCCTTTCCTGG - Intronic
1078514175 11:12008749-12008771 TGTAGGGGAGCTGCGTTTTCAGG - Intronic
1078604837 11:12765945-12765967 AGAAAGGGAGCTGCATTTTCAGG - Intronic
1080002846 11:27370482-27370504 TGGAAGCCTGCTGCCTCCTCTGG + Intronic
1081733786 11:45389846-45389868 AGAAAGGGTGCTGCCTCATCAGG - Intergenic
1082072061 11:47947177-47947199 TGGCAGGTTCCTGCCTTTTTGGG + Intergenic
1082768308 11:57185883-57185905 TAGGAGGGGGCTGCTTTTTCTGG - Intronic
1082952852 11:58835933-58835955 TTGAAGAGTGTTGACTTTTCTGG + Intronic
1083110147 11:60398086-60398108 GTGAAGGGAGCTGCCTTTTTTGG - Intronic
1083851982 11:65373404-65373426 TGGGAATGTGCTGCCCTTTCGGG - Intergenic
1086405442 11:86495418-86495440 TGGAAGGGTGCTGTCTGCCCTGG - Intronic
1088584569 11:111351249-111351271 TGGAAGGGGTCTCCCTTTCCTGG - Intergenic
1089409393 11:118226855-118226877 AGGAATGGAGCTGCCTCTTCTGG + Exonic
1090704585 11:129324928-129324950 TGAAAGGCTGCTGCCATTTGAGG - Intergenic
1091409718 12:231225-231247 GGGCAGGTTGCTGCCTTTCCCGG - Intronic
1093967169 12:25340125-25340147 TGGAAGGGACTTGCCTTGTCTGG - Intergenic
1095954101 12:47796795-47796817 TTGAAGGGTGCCCCCTTTTCTGG + Intronic
1096603972 12:52751905-52751927 AGGAATGGTGGTGCCTTCTCAGG - Intergenic
1096767785 12:53907837-53907859 AGGAAGGCTGCTGCCCTGTCTGG + Intergenic
1096813873 12:54189232-54189254 TGGAAGGGCGATGCCCTTTAGGG - Intergenic
1097394993 12:59062255-59062277 TGGCAGGCTCCTGTCTTTTCTGG - Intergenic
1097624842 12:61987576-61987598 AGGAAGGGTGCAGACTTTTCTGG - Intronic
1097733095 12:63151367-63151389 TGGACGAGTCATGCCTTTTCTGG + Intergenic
1102257640 12:111425372-111425394 TGGGAGGGGGCTGCCTTCCCTGG + Intronic
1102752298 12:115305984-115306006 TGCCAGGGTGCTGTCTTCTCAGG + Intergenic
1111234597 13:85392321-85392343 TGAAAGTGTGCTTCCTTTACGGG - Intergenic
1112495440 13:99900298-99900320 TGGGAGTGTGCCGCCCTTTCTGG - Intergenic
1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG + Intronic
1113994083 14:16052829-16052851 GGGAAGAGTGCTGCCTGATCTGG + Intergenic
1114597896 14:23929868-23929890 TGGCAGGGTGCTGCCTTGAGGGG - Intergenic
1114792811 14:25679029-25679051 TGGCAGGGCGGTGCTTTTTCTGG + Intergenic
1118692860 14:68356623-68356645 TTGAAGGTTGCTGACTGTTCAGG + Intronic
1121718038 14:96090016-96090038 AGAAAGGGTCCTGCATTTTCTGG + Exonic
1126271977 15:46830077-46830099 TGGAAAAATACTGCCTTTTCAGG - Intergenic
1126688611 15:51269699-51269721 TGGAAGAGTCCTGCCTTGGCTGG - Intronic
1127318073 15:57816283-57816305 TCGATGGGTGCTCCCTTCTCTGG + Intergenic
1131585920 15:93692499-93692521 TGGCATTTTGCTGCCTTTTCAGG + Intergenic
1133144588 16:3775057-3775079 TGTGAGGGTGCTGTCCTTTCAGG - Intronic
1138316709 16:56076572-56076594 GGGATGGGTGCTGACATTTCGGG - Intergenic
1139478455 16:67215150-67215172 ATGGAGGGTGCTGCCTTTGCCGG + Intronic
1140039510 16:71396839-71396861 TGGAAGGCTGCGGCCTAATCGGG - Intergenic
1141296851 16:82777782-82777804 TGGCAGGATTCTGCTTTTTCAGG + Intronic
1141979244 16:87539662-87539684 TGGAAGGAAGCTTACTTTTCAGG - Intergenic
1143491483 17:7287634-7287656 TGGAAGGGTGCTGCATCCACAGG + Exonic
1144414866 17:15036706-15036728 TGGAAGTCTGCAGCCTTTTTCGG + Intergenic
1146593217 17:34146678-34146700 TTGACAGGTGCTGCCTCTTCTGG - Intronic
1151163214 17:72183254-72183276 TGTAAGGTTGCTCCCTGTTCTGG + Intergenic
1154056660 18:11019165-11019187 TAGAAGGCTGCTGCCTTCTGTGG - Intronic
1155225522 18:23726162-23726184 GGGAGGGGTGCTGCATTTCCCGG - Intronic
1158322046 18:56274044-56274066 TGGAAGTGTGCAGCCTTGTATGG - Intergenic
1160020426 18:75176390-75176412 TGGAGCTGTGCTGCCATTTCTGG + Intergenic
1160955730 19:1690968-1690990 TGGAGGGGCGCTGCCTTGTGTGG - Intergenic
1161918092 19:7245284-7245306 TAGAAGAGTGTTTCCTTTTCTGG - Intronic
1162403093 19:10457759-10457781 TGAAAGGGTTCTGCCGTTTCGGG + Intronic
1165406964 19:35636970-35636992 TGGAGGGGTGTTTCCATTTCTGG - Intronic
1166653852 19:44595836-44595858 GGAAAGGGAGCTGCCTTTGCGGG + Intergenic
1166688444 19:44809426-44809448 GGGAAGGGGGCTGACTTCTCTGG - Intronic
1168494961 19:56840357-56840379 TGGATGGTTGGTGCCTTTTTGGG - Intronic
925273166 2:2629763-2629785 AGGAAGGGTGCAGCCTTATCCGG - Intergenic
925914457 2:8595045-8595067 TGTAAGTGTGCTGCCTCTTGGGG + Intergenic
927130025 2:20051284-20051306 TGGAGGGGCGCTGCTTTTTAAGG - Intronic
930855710 2:56015781-56015803 AGGAAGGAAGCTGCCTTTGCTGG + Intergenic
931796853 2:65719440-65719462 TGGAACGGTGGTGCCTCCTCTGG + Intergenic
932310781 2:70738529-70738551 GGGAAGGTTGCTCACTTTTCTGG - Intronic
932464254 2:71905311-71905333 TGGTAAGTTACTGCCTTTTCTGG + Intergenic
932849687 2:75172475-75172497 TGGAAGGGGGCTGCCTAGACGGG - Intronic
935386893 2:102509275-102509297 TGGAGGGATGCAGCCTTTGCAGG - Intronic
938537575 2:132258041-132258063 GGGAAGGGTGCCGCCTGATCTGG - Intergenic
938696890 2:133842751-133842773 TGGAAGCATCCAGCCTTTTCAGG - Intergenic
944205982 2:197158839-197158861 TTGAAGGCTGCTGCATCTTCAGG - Intronic
944437174 2:199702849-199702871 TCGATGGCTGATGCCTTTTCAGG - Intergenic
944872038 2:203921838-203921860 TGGCAGGGTGCTGCTTGGTCAGG + Intergenic
1171768336 20:29301986-29302008 GGGAAGGGTGCCGCCTGGTCTGG - Intergenic
1174284700 20:49464476-49464498 TGAATGGCTGCTGCCTTCTCAGG + Intronic
1175761312 20:61563676-61563698 TGGAAGGGAGCTGCATTTGCAGG - Intronic
1176653667 21:9571529-9571551 TGAAACAGTGCTCCCTTTTCAGG + Intergenic
1178637104 21:34313737-34313759 TGGAAGGCTGTTGCATTCTCAGG - Intergenic
1180313185 22:11254686-11254708 GGGAAGAGTGCTGCCTGATCTGG - Intergenic
1181971303 22:26692387-26692409 TAAAAGGATGCTGCCTTTCCAGG - Intergenic
1182632202 22:31695347-31695369 TGGAAGGGAGCTTCTCTTTCCGG + Intronic
1184894174 22:47397486-47397508 TGGAAGGGGGCTGGGGTTTCAGG + Intergenic
950794267 3:15497857-15497879 TTGTAGGGTGCAGCCTTCTCTGG - Intronic
953613794 3:44471481-44471503 TGGAAGGGGTCAGCATTTTCAGG - Intronic
953794100 3:45969853-45969875 TGGTAGGGGGCTGCCTTCCCAGG + Intronic
954642348 3:52108662-52108684 TGGAGGGCTGCTGCTTTTGCGGG - Intronic
954938379 3:54347863-54347885 TGGGAGGGTACTGCCTTCTAGGG - Intronic
956162837 3:66372930-66372952 TGGAATGGTGCTGCCCTCTCGGG + Intronic
956872692 3:73433751-73433773 TGTAAGGGAGCTGCTTTTCCCGG - Intronic
960029438 3:113042504-113042526 TCTAAGGGTTCTGCTTTTTCTGG - Intergenic
962100527 3:132337530-132337552 TATAAGGGTGCAGCCTCTTCTGG - Exonic
962254488 3:133861044-133861066 TGGAAGGGTTCAGCCTCTGCAGG - Intronic
966257527 3:177934506-177934528 TTTAAGGGAGATGCCTTTTCCGG - Intergenic
967788826 3:193525613-193525635 GGGAAGGCTGCTCCATTTTCAGG + Intronic
968810710 4:2798572-2798594 TGGAAAGGGGCTTCCCTTTCTGG - Intronic
972852695 4:43070692-43070714 TGGCAGGGGGCGGCCTTTGCTGG - Intergenic
974271091 4:59652170-59652192 TGGAAGGGACTTGCCTTGTCTGG + Intergenic
976198155 4:82552902-82552924 TGGAAGGGTGCTGCATCTTAGGG + Intronic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
980977262 4:139623310-139623332 TGGCAGGGTGGTGACTTGTCAGG + Intergenic
981655185 4:147104924-147104946 TGAAAGGCTGCTGCGTTTCCTGG + Intergenic
983651459 4:170040539-170040561 TGGACTTGTGGTGCCTTTTCTGG + Intergenic
989255750 5:39364186-39364208 TGGAAATGTGCTGCTGTTTCTGG - Intronic
990173686 5:53083587-53083609 TGGAAGTGTGCTGCCTTTCAGGG - Intronic
990955721 5:61336294-61336316 TGGAAGGGAGCTGCCTCTATAGG + Intronic
993097287 5:83494228-83494250 TGTAAGGGTGGTACCTATTCTGG + Intronic
995406230 5:111799855-111799877 TGAAAGAATGTTGCCTTTTCAGG + Intronic
995636768 5:114201942-114201964 TGGGAGGGACCTGCCCTTTCTGG - Intergenic
997356638 5:133266896-133266918 TGGGAGGGTCCTGACGTTTCTGG + Intronic
999927539 5:156395535-156395557 GGGAAGGTTGCTGCATTTTGTGG + Intronic
1001132776 5:169078516-169078538 AGGAAGGGTGCTGGGTTTGCGGG - Intronic
1002260609 5:177991558-177991580 AGGAAGGGACCTGCCTCTTCTGG - Intergenic
1003193286 6:3892682-3892704 TAGAAGGGTATTGCCCTTTCTGG - Intergenic
1003459651 6:6318411-6318433 TGGCAGGGGGCTTCCTTTTGTGG + Intronic
1005672702 6:28123355-28123377 AGGAAGGGTGCTTGTTTTTCTGG - Intergenic
1009313751 6:62190951-62190973 TGAAGGGGTCCTGCCTATTCAGG - Intronic
1009317155 6:62234150-62234172 TAGAAGGGTGCTGTTTTTTGAGG - Intronic
1009643161 6:66363025-66363047 TGGCAGGGGGCTGCCATGTCGGG + Intergenic
1010160694 6:72850653-72850675 TGGAAGAATGCTGCCTTTCCAGG + Intronic
1010398562 6:75421551-75421573 AGGAAGGGTGCTGATGTTTCAGG - Intronic
1012940330 6:105408662-105408684 TTGAAGGGTCCTGCCATTGCCGG - Intergenic
1013050643 6:106531515-106531537 TGGAAGTGGGCTGCCTTGTTAGG + Intronic
1013411913 6:109890508-109890530 TGGCAGGGTTCTGCCATATCTGG - Intergenic
1013612363 6:111807047-111807069 TGGAATGTTGATGCCTTTTCTGG + Intronic
1014158549 6:118139534-118139556 TGGAAGGATGCTGACTTTCCAGG + Intronic
1014410504 6:121113077-121113099 TGGAAGTTTGCTGCTGTTTCAGG + Exonic
1016609508 6:145972647-145972669 TGGAAAGGTTCTTCATTTTCTGG - Intergenic
1017525288 6:155237043-155237065 TGGAAGGGACTTGCCTTCTCTGG - Intronic
1017707910 6:157140809-157140831 TGGAAGGCCGCTGCCTCTCCCGG - Intronic
1019368009 7:645129-645151 TGGGTGGGTGCTGCCCTCTCTGG - Intronic
1022634745 7:32120615-32120637 TGGAGGGCTGCTGTCTTTACTGG - Intronic
1022980657 7:35602025-35602047 AGGTAGGGGGCTGCCTTCTCTGG - Intergenic
1023108774 7:36789367-36789389 TGGACGTGTGCTGGGTTTTCAGG - Intergenic
1023548673 7:41345514-41345536 TGGGCGAGTGCTGCATTTTCAGG + Intergenic
1023904357 7:44511967-44511989 TGGAAAGGAGCTGGCGTTTCTGG - Intergenic
1027435469 7:78159697-78159719 AGGAGGGGTGCTTCCTTTTATGG - Intronic
1028487076 7:91371761-91371783 TGGAAGGATACTGCAATTTCTGG - Intergenic
1033260531 7:139840318-139840340 TGGAGGCGGGATGCCTTTTCCGG - Intronic
1033839327 7:145354837-145354859 TAGAAGGTTGCTACCTCTTCTGG + Intergenic
1035577236 8:715638-715660 GGTCAGGGTGCTGCCTTTTTGGG - Intronic
1036209555 8:6831288-6831310 AGGAAGGGCCCTGTCTTTTCAGG + Intronic
1038197394 8:25380906-25380928 TGGAATGGTGCTGCCTCCACTGG - Intronic
1038964466 8:32556005-32556027 GGGCAGGGAGCTGCCTTCTCTGG + Intronic
1039797863 8:40930777-40930799 TGGGAGGCTGCTGCATCTTCAGG - Intergenic
1040951013 8:52939333-52939355 GGGAAGGGGTCTGCCTTTCCTGG - Exonic
1041658681 8:60379410-60379432 TGCAAGGGTTCTGCATTTTCTGG - Intergenic
1044465347 8:92497203-92497225 TGGAAGGTTGCTGGGTTTTGGGG + Intergenic
1047433557 8:124815242-124815264 TTGAAGAGTGCTGCCTTATCTGG - Intergenic
1047738330 8:127786013-127786035 TGGAAGGTTTTTGCTTTTTCTGG + Intergenic
1048445073 8:134487314-134487336 TGGGAGGGGCCTACCTTTTCAGG - Intronic
1049185445 8:141249503-141249525 TGTCATGGTGCTGCCTGTTCGGG - Intronic
1049705245 8:144039229-144039251 TGGAGGAGTGCTCCTTTTTCTGG - Intronic
1051353653 9:16221536-16221558 TGGCAGGGTGCCACCCTTTCAGG - Intronic
1055400871 9:75922638-75922660 GGCTAGGGTGCTGCATTTTCTGG - Intronic
1203631387 Un_KI270750v1:74976-74998 TGAAACAGTGCTCCCTTTTCAGG + Intergenic
1186871661 X:13780051-13780073 TGGAAGGATTGTGCATTTTCAGG + Intronic
1190681744 X:52831709-52831731 TGGACTTGTGGTGCCTTTTCTGG + Intergenic
1191904213 X:66071765-66071787 TTGAAGAGTGCTTCCTATTCAGG - Intergenic
1195859148 X:109362483-109362505 TGAAAGGGTACTTTCTTTTCTGG + Intergenic
1196055359 X:111349483-111349505 AGGAAGGATGCTAACTTTTCAGG + Intronic
1199555460 X:149103359-149103381 GGGTAGGGTGCTGCCTGTGCGGG + Intergenic