ID: 1070513277

View in Genome Browser
Species Human (GRCh38)
Location 10:77180175-77180197
Sequence TGGAAGGGTGCTGCCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070513277_1070513280 -8 Left 1070513277 10:77180175-77180197 CCAGAAAAGGCAGCACCCTTCCA No data
Right 1070513280 10:77180190-77180212 CCCTTCCACTTTCCAGGAGAAGG No data
1070513277_1070513287 24 Left 1070513277 10:77180175-77180197 CCAGAAAAGGCAGCACCCTTCCA No data
Right 1070513287 10:77180222-77180244 CCTGAAATGCCCCTATTTAATGG No data
1070513277_1070513282 -7 Left 1070513277 10:77180175-77180197 CCAGAAAAGGCAGCACCCTTCCA No data
Right 1070513282 10:77180191-77180213 CCTTCCACTTTCCAGGAGAAGGG No data
1070513277_1070513288 25 Left 1070513277 10:77180175-77180197 CCAGAAAAGGCAGCACCCTTCCA No data
Right 1070513288 10:77180223-77180245 CTGAAATGCCCCTATTTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070513277 Original CRISPR TGGAAGGGTGCTGCCTTTTC TGG (reversed) Intronic