ID: 1070513280

View in Genome Browser
Species Human (GRCh38)
Location 10:77180190-77180212
Sequence CCCTTCCACTTTCCAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070513272_1070513280 16 Left 1070513272 10:77180151-77180173 CCTGCATCTTATCCCAAACCTCA No data
Right 1070513280 10:77180190-77180212 CCCTTCCACTTTCCAGGAGAAGG No data
1070513276_1070513280 -2 Left 1070513276 10:77180169-77180191 CCTCAGCCAGAAAAGGCAGCACC No data
Right 1070513280 10:77180190-77180212 CCCTTCCACTTTCCAGGAGAAGG No data
1070513277_1070513280 -8 Left 1070513277 10:77180175-77180197 CCAGAAAAGGCAGCACCCTTCCA No data
Right 1070513280 10:77180190-77180212 CCCTTCCACTTTCCAGGAGAAGG No data
1070513275_1070513280 3 Left 1070513275 10:77180164-77180186 CCAAACCTCAGCCAGAAAAGGCA No data
Right 1070513280 10:77180190-77180212 CCCTTCCACTTTCCAGGAGAAGG No data
1070513274_1070513280 4 Left 1070513274 10:77180163-77180185 CCCAAACCTCAGCCAGAAAAGGC No data
Right 1070513280 10:77180190-77180212 CCCTTCCACTTTCCAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070513280 Original CRISPR CCCTTCCACTTTCCAGGAGA AGG Intronic