ID: 1070513283 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:77180195-77180217 |
Sequence | GCTGCCCTTCTCCTGGAAAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1070513283_1070513287 | 4 | Left | 1070513283 | 10:77180195-77180217 | CCACTTTCCAGGAGAAGGGCAGC | No data | ||
Right | 1070513287 | 10:77180222-77180244 | CCTGAAATGCCCCTATTTAATGG | No data | ||||
1070513283_1070513288 | 5 | Left | 1070513283 | 10:77180195-77180217 | CCACTTTCCAGGAGAAGGGCAGC | No data | ||
Right | 1070513288 | 10:77180223-77180245 | CTGAAATGCCCCTATTTAATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1070513283 | Original CRISPR | GCTGCCCTTCTCCTGGAAAG TGG (reversed) | Intronic | ||