ID: 1070513287

View in Genome Browser
Species Human (GRCh38)
Location 10:77180222-77180244
Sequence CCTGAAATGCCCCTATTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070513281_1070513287 8 Left 1070513281 10:77180191-77180213 CCTTCCACTTTCCAGGAGAAGGG No data
Right 1070513287 10:77180222-77180244 CCTGAAATGCCCCTATTTAATGG No data
1070513279_1070513287 9 Left 1070513279 10:77180190-77180212 CCCTTCCACTTTCCAGGAGAAGG No data
Right 1070513287 10:77180222-77180244 CCTGAAATGCCCCTATTTAATGG No data
1070513283_1070513287 4 Left 1070513283 10:77180195-77180217 CCACTTTCCAGGAGAAGGGCAGC No data
Right 1070513287 10:77180222-77180244 CCTGAAATGCCCCTATTTAATGG No data
1070513284_1070513287 -3 Left 1070513284 10:77180202-77180224 CCAGGAGAAGGGCAGCCATGCCT No data
Right 1070513287 10:77180222-77180244 CCTGAAATGCCCCTATTTAATGG No data
1070513276_1070513287 30 Left 1070513276 10:77180169-77180191 CCTCAGCCAGAAAAGGCAGCACC No data
Right 1070513287 10:77180222-77180244 CCTGAAATGCCCCTATTTAATGG No data
1070513277_1070513287 24 Left 1070513277 10:77180175-77180197 CCAGAAAAGGCAGCACCCTTCCA No data
Right 1070513287 10:77180222-77180244 CCTGAAATGCCCCTATTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070513287 Original CRISPR CCTGAAATGCCCCTATTTAA TGG Intronic