ID: 1070513288

View in Genome Browser
Species Human (GRCh38)
Location 10:77180223-77180245
Sequence CTGAAATGCCCCTATTTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070513284_1070513288 -2 Left 1070513284 10:77180202-77180224 CCAGGAGAAGGGCAGCCATGCCT No data
Right 1070513288 10:77180223-77180245 CTGAAATGCCCCTATTTAATGGG No data
1070513279_1070513288 10 Left 1070513279 10:77180190-77180212 CCCTTCCACTTTCCAGGAGAAGG No data
Right 1070513288 10:77180223-77180245 CTGAAATGCCCCTATTTAATGGG No data
1070513281_1070513288 9 Left 1070513281 10:77180191-77180213 CCTTCCACTTTCCAGGAGAAGGG No data
Right 1070513288 10:77180223-77180245 CTGAAATGCCCCTATTTAATGGG No data
1070513277_1070513288 25 Left 1070513277 10:77180175-77180197 CCAGAAAAGGCAGCACCCTTCCA No data
Right 1070513288 10:77180223-77180245 CTGAAATGCCCCTATTTAATGGG No data
1070513283_1070513288 5 Left 1070513283 10:77180195-77180217 CCACTTTCCAGGAGAAGGGCAGC No data
Right 1070513288 10:77180223-77180245 CTGAAATGCCCCTATTTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070513288 Original CRISPR CTGAAATGCCCCTATTTAAT GGG Intronic