ID: 1070528247

View in Genome Browser
Species Human (GRCh38)
Location 10:77313399-77313421
Sequence GTGAAGGCCCTGTCCCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070528247_1070528250 24 Left 1070528247 10:77313399-77313421 CCATGAGGGGACAGGGCCTTCAC 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1070528250 10:77313446-77313468 GCATATGTTCATTTTGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070528247 Original CRISPR GTGAAGGCCCTGTCCCCTCA TGG (reversed) Intronic
900386159 1:2412062-2412084 GGGAAGACTCTGTCCCCTCCAGG - Intronic
900386562 1:2413424-2413446 GGGAAGGTTCTGTCCCCTCCAGG - Intronic
900587361 1:3439738-3439760 GAGCAGACCCAGTCCCCTCAGGG + Intergenic
901185127 1:7368030-7368052 GTGCAGGCCCTGGGCACTCATGG + Intronic
901202639 1:7475441-7475463 GTGGAGGCCAGGACCCCTCAGGG - Intronic
904972638 1:34431185-34431207 TTGAAGGCCCTGAACCGTCATGG + Intergenic
905466334 1:38156600-38156622 GAGGAGGCCCTGTCCCCTTGAGG + Intergenic
906694978 1:47817704-47817726 ATGAGGGCCCAGTCCCTTCACGG + Intronic
908733945 1:67256465-67256487 GTAATGTCCCTGTACCCTCAGGG - Intronic
912648204 1:111415008-111415030 GAGAAGGCCCTGACCCCTGTGGG - Exonic
912764512 1:112396391-112396413 GAGACGGCCCCGCCCCCTCAGGG - Intronic
912867339 1:113269640-113269662 CTGAGGGTCCTGGCCCCTCAGGG + Intergenic
916894056 1:169143152-169143174 GTCAACGCCCATTCCCCTCAAGG + Intronic
918466099 1:184822993-184823015 GGGAAGGCCCAGGCCCCTAATGG + Intronic
923328452 1:232900807-232900829 GTGAGCGCCCTAACCCCTCAGGG - Intergenic
1067289628 10:44931741-44931763 GTGAAGGCCATGTCACCTGCTGG + Intronic
1069918967 10:71804715-71804737 GTGTAAGCCCTGTCCCTGCAGGG - Intronic
1070528247 10:77313399-77313421 GTGAAGGCCCTGTCCCCTCATGG - Intronic
1072538847 10:96383215-96383237 CTGAAGGCCATGAACCCTCAGGG - Intronic
1074505505 10:114066982-114067004 GTGAAGGCCCTTCCCTCTCTGGG - Intergenic
1076202188 10:128567647-128567669 TCGAAGGCCCTGTCTGCTCAGGG - Intergenic
1076617276 10:131763874-131763896 GTGGCAGCCCTGCCCCCTCAGGG + Intergenic
1076795336 10:132795410-132795432 GGGAAGGCCGTGACCCCTCTAGG - Intergenic
1077369185 11:2173642-2173664 GTGCAGACCCTGTCCTCTCTCGG + Intergenic
1078455589 11:11472150-11472172 GTGGAGCCCCTGTCCTGTCATGG - Intronic
1078627331 11:12969385-12969407 GTCAAGGACCTGTCCTCTGATGG + Intergenic
1084688284 11:70710164-70710186 GTCAAGGCCCTGTCTTCCCACGG - Intronic
1085119607 11:73958694-73958716 GGGAAGGTCCCGTCCCCGCAGGG - Intronic
1086163767 11:83753004-83753026 GTAAATTCACTGTCCCCTCAAGG - Intronic
1087634400 11:100687018-100687040 GTGTTAGCCCTGTCCCCTCTTGG - Intergenic
1089530687 11:119126936-119126958 GTGAAGGCCATGCCGCCTCCTGG + Exonic
1089707763 11:120292812-120292834 GGGAGGGCGCTGTGCCCTCATGG - Intronic
1090405505 11:126473705-126473727 CTGCTGGCCCTGTCCCCTCCTGG - Intronic
1091302821 11:134518428-134518450 TTGTAGACCCTGTTCCCTCAGGG + Intergenic
1091616686 12:2054934-2054956 GTGAAGGCCCTGTCCCCAAAAGG - Intronic
1092246879 12:6868637-6868659 GTGAGGGCCGTGGCCTCTCAGGG + Intronic
1092303326 12:7273680-7273702 GTCAAGGCCCTGTCCTCTAAGGG + Intergenic
1096490588 12:52010626-52010648 GAGAAGGGCCGGTCCCCTGAAGG - Intronic
1097278644 12:57830564-57830586 TTTAAGGCCCCCTCCCCTCAAGG + Intronic
1103439940 12:120955524-120955546 GTGAAGGCTGATTCCCCTCATGG - Intergenic
1110696729 13:78499850-78499872 GAGAAGGCCCTGTTTCCTCGGGG - Intergenic
1113869799 13:113552228-113552250 GTGAAGGCCGTGTAAGCTCATGG - Intronic
1120086222 14:80276921-80276943 GTGAAGTCTCTGTCCCTTCCTGG - Intronic
1120206453 14:81591890-81591912 GTGAAGACCCTGTCTCCTGGTGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122737988 14:103854900-103854922 GGGAAGGCCCTCTGCCCTCAGGG - Intergenic
1123039826 14:105485955-105485977 GTGCTGGCCCTGTCCCCGCTGGG - Intergenic
1202902888 14_GL000194v1_random:53399-53421 GTGAAGGCCCAGTCCCCACCTGG + Intergenic
1125760387 15:42092526-42092548 GTGACGCCCCTATGCCCTCAGGG - Intronic
1127439413 15:58991420-58991442 GTGAAGGCACTCTGCCTTCATGG + Intronic
1130069513 15:80634729-80634751 GAGAAAGTCCTGTCCCCTCAAGG - Intergenic
1130625425 15:85509067-85509089 GACAAGGCCCTTTGCCCTCATGG - Intronic
1132934687 16:2474545-2474567 GGGGACGCCCTGTCCCCCCATGG - Intergenic
1133153594 16:3855698-3855720 GTACAGGCCCTGTGCCCTCATGG - Intronic
1133643692 16:7743050-7743072 GTGACAGAGCTGTCCCCTCAAGG - Intergenic
1136129139 16:28208435-28208457 GGGTAGGCCCTGTCCCCCAAAGG - Intronic
1137790226 16:51168825-51168847 CTGAAGGCTGGGTCCCCTCACGG + Intergenic
1138896698 16:61214558-61214580 GTGAAGTGTCTGACCCCTCAAGG - Intergenic
1139468816 16:67167558-67167580 GAGAAAGCCTGGTCCCCTCAGGG - Exonic
1141436787 16:84004180-84004202 GTGAAGCCCCTGATCCTTCAAGG - Intergenic
1141673931 16:85507620-85507642 GTGAACGCCGTGTTCCCTCTGGG + Intergenic
1142149072 16:88504839-88504861 GGCAAGGCCCTGGCCCCACAGGG - Intronic
1143015976 17:3891536-3891558 GAGCAAGCACTGTCCCCTCATGG - Intronic
1144520902 17:15951705-15951727 CTGAAGGCCCTCTCCCTTCGGGG + Intronic
1144796592 17:17895685-17895707 GGGATGGCCCTGTGGCCTCAAGG - Intronic
1145246640 17:21273922-21273944 GCACAGCCCCTGTCCCCTCATGG - Intergenic
1145797594 17:27664864-27664886 GTGTGGGCCCTGTCCCCTGGTGG + Intergenic
1145888338 17:28397808-28397830 CTGAAGGCTCTTTCCCCGCAAGG + Exonic
1151540965 17:74764342-74764364 GGGGAGGCCCTGTCCCCTTCTGG + Intronic
1152629908 17:81406244-81406266 GGGGAGGCCATCTCCCCTCAAGG - Intronic
1152984228 18:307462-307484 GAGGTGGCCCTGTCCCCTGAAGG + Intergenic
1153047649 18:871390-871412 GTGAAGGCCAGGTCCCCAAATGG - Intergenic
1154412010 18:14146701-14146723 GAGAAGGCGCTCTCCCCACAGGG + Intergenic
1155623864 18:27812481-27812503 TTGAAGGCCCTCTCTCCACATGG - Intergenic
1157386772 18:47264228-47264250 GAGAAGGCGCTGTTGCCTCAGGG - Intergenic
1157530817 18:48419009-48419031 CTGGAGGCCCTGTCCTCCCAGGG + Intergenic
1159980723 18:74776222-74776244 ATGAAGGCCCGTTCCCCTTAGGG - Intronic
1160823693 19:1069616-1069638 GGGAAGGCCCGGTCCCCACTGGG + Intronic
1161479384 19:4503121-4503143 CTGAATGCCCCGGCCCCTCACGG + Exonic
1161981407 19:7632298-7632320 GGGCAGGCCCTGTTCCCTCCTGG + Intronic
1164085728 19:21900502-21900524 CTGCAGACTCTGTCCCCTCAGGG - Intergenic
1165247249 19:34504792-34504814 GAGAAGGCCCTTCCCCATCACGG + Exonic
1168273922 19:55265830-55265852 GTGGGGGCCCCGTCCTCTCAAGG - Intronic
926306008 2:11637660-11637682 GGGAAGGTCCTCGCCCCTCAGGG + Intronic
927845010 2:26466937-26466959 GTGAAGGCCCTGCCACATCAGGG - Intronic
929947619 2:46382443-46382465 GGGATGGCCCAGGCCCCTCATGG - Exonic
930027659 2:47039192-47039214 CTGAAGGCCCTGTCTCAACAGGG + Intronic
930371713 2:50509920-50509942 GTGAGGGCCCTATCCCATCATGG - Intronic
936626723 2:114156598-114156620 GCGGAGGCCCAGTCCCGTCAGGG - Intergenic
937812080 2:126210584-126210606 AGGAAGGCCTTGTCTCCTCAGGG + Intergenic
946488622 2:220126019-220126041 GGGGAGGTCCTGTCCCCTCTGGG - Intergenic
948194778 2:236087241-236087263 TGGAATGCCCTGTCCCCTGATGG - Intronic
948834790 2:240620666-240620688 GTGATGGCCCCATCCCCACAGGG - Intronic
1172054134 20:32142449-32142471 GTGCAGCCCCTGTCCCCAAAGGG + Intronic
1172097206 20:32466352-32466374 GTGTAGGCCCTGCCCACTCCTGG + Intronic
1173258626 20:41413449-41413471 TGGCAGGCCCTGGCCCCTCAGGG + Exonic
1173580670 20:44144426-44144448 GTAACAGCCCTGTCCCCCCAAGG - Intronic
1175463842 20:59175966-59175988 GGGAAGGCCCTGTTACCTCCTGG + Intergenic
1176622252 21:9068166-9068188 GTGAAGGCCCAGTCCCCACCTGG + Intergenic
1179420158 21:41229106-41229128 GGGAAGGTCCTGTCCCCTAGGGG - Intronic
1179595290 21:42438959-42438981 GTGAAGGTCCCGGCCCCTCGTGG - Intronic
1179957444 21:44749471-44749493 GAGAAGGCCGGATCCCCTCACGG + Intergenic
1180041733 21:45283688-45283710 CTGATGGCCCTGTGCCCTCATGG - Intronic
1180159080 21:45991058-45991080 GTGAAGGCCCTGGTCCTCCAGGG - Intronic
1180912736 22:19464232-19464254 GTGACGGCCCAGTCCCCGAAGGG + Intronic
1182112632 22:27734258-27734280 CAGAAGGCCCTGTCCCGGCAGGG - Intergenic
1182423293 22:30258911-30258933 CTGAAGGCCCCGTCCCTCCAGGG + Intergenic
1183746851 22:39697156-39697178 GGGCAGGCGCTGTCCCCTCCTGG + Intergenic
1184687962 22:46104916-46104938 GTGGAGGACCTGTTCCCTCCTGG + Intronic
950202729 3:11056542-11056564 GGGAAGGGCCTGTCCCCTGTGGG + Intergenic
950446459 3:13041698-13041720 CTGCAGCCCCTGTCACCTCAGGG + Intronic
956664789 3:71632002-71632024 GTGATGCCCCTGTCCCCTGGGGG - Intergenic
968084368 3:195867890-195867912 CGGGAGCCCCTGTCCCCTCAAGG - Exonic
968647681 4:1748613-1748635 GGAAAAGCCCTGTCCCCACAGGG + Intergenic
968704758 4:2072704-2072726 GTGAAGGCTTGGTCCACTCAAGG - Intronic
968765346 4:2465532-2465554 GTGAAGGCCCTGGGCTCTTAAGG - Intronic
968765370 4:2465604-2465626 GTGAAGGCCCTGGGCTCTTAAGG - Intronic
968765394 4:2465676-2465698 GTGAAGGCCCTGGGCTCTTAAGG - Intronic
968871104 4:3243014-3243036 GAGAAGGCCCTGTGCCCTAAAGG + Exonic
968967976 4:3778948-3778970 GGGAAGGCCCATTCCCCCCATGG + Intergenic
975885212 4:78956905-78956927 ATGACGAGCCTGTCCCCTCAAGG - Intergenic
976146069 4:82043974-82043996 GTGGAGGGTGTGTCCCCTCAGGG - Intronic
979437721 4:120713898-120713920 GTGAATTCCCTGTCCTCACATGG + Intronic
980339736 4:131529875-131529897 ATGAAGTCACTCTCCCCTCAGGG - Intergenic
982129253 4:152212514-152212536 GACAAGGCCCTGCCCCCTCCTGG - Intergenic
984760582 4:183359583-183359605 ATGAAGGCCCTGTCCAGTCTGGG + Intergenic
985512551 5:320893-320915 CTGAATTCCCTGTACCCTCAGGG - Intronic
985975528 5:3416673-3416695 GGGAGGGCCCTCTCCCCACAAGG + Intergenic
990864984 5:60370145-60370167 GTGAAGGCTCTGTCCTGTTAGGG - Intronic
993796090 5:92268952-92268974 GTGAAGCTCCTGTCCTTTCATGG - Intergenic
994208582 5:97062634-97062656 GTGTAGGCCATTTACCCTCAAGG - Intergenic
999132414 5:149294654-149294676 GTGAAGGCCCTCTCCCCACTGGG - Intronic
1000029650 5:157390757-157390779 GTGAAGGCCAGCTCCCCACACGG + Intronic
1001803104 5:174560284-174560306 CTGAAGGACCTCTCCCCTCTGGG + Intergenic
1005739223 6:28775147-28775169 GAGAAGCCCAAGTCCCCTCAGGG - Intergenic
1007808521 6:44469806-44469828 TTGAGGGCCACGTCCCCTCAGGG - Intergenic
1017206342 6:151807870-151807892 GTGCAGACCGTGTCCCCGCAGGG - Exonic
1022631445 7:32089056-32089078 GTGATGGCTCTGTCCACACATGG - Intronic
1027246540 7:76371390-76371412 GCGAATGACCTGCCCCCTCATGG + Intergenic
1033190444 7:139274037-139274059 GTGAAGCCCCTGTGGCCTAAGGG + Exonic
1035458676 7:159025716-159025738 GGGAAGTCCTTGTCCTCTCATGG + Intergenic
1037730989 8:21523978-21524000 CTGAAGACGCTGTCCCATCATGG + Intergenic
1038157595 8:25004841-25004863 TTGAAGGCCAAGTCCCATCAAGG + Intergenic
1046013925 8:108583431-108583453 GGGAAGATCCTGTCCACTCAGGG - Intergenic
1048050301 8:130810060-130810082 ATGAAGGCACTGCCACCTCAGGG + Intronic
1048595872 8:135865271-135865293 GTTAAGTCTCTTTCCCCTCACGG + Intergenic
1049729560 8:144168894-144168916 GGCAAGGCCCTGGCCCCTCCTGG - Intronic
1049802314 8:144523568-144523590 GTGAAGGGCCTGCCGCCCCAAGG - Exonic
1051627084 9:19108628-19108650 CTAATGGCCCTGTCCTCTCAGGG - Intronic
1051796478 9:20877214-20877236 GTGATGGCCCAAACCCCTCAAGG - Intronic
1052679636 9:31672969-31672991 GTGAATGCTGTGTCCTCTCATGG + Intergenic
1057192064 9:93093896-93093918 CTGAAAGCCCTGTGCCCTCTGGG - Intergenic
1060781163 9:126414381-126414403 GTGAGAGCCCTGTCTCCTCCGGG + Intronic
1061652386 9:132061265-132061287 CTGCAGGCCCTGTCCCTTGAGGG + Intronic
1061727043 9:132587693-132587715 GGCAAGGCCTTGTCCCCTTAGGG - Intronic
1062615363 9:137393708-137393730 GTGAAAGCCCTGCTCCCACATGG - Intronic
1190216352 X:48481804-48481826 GGGGAGGCTCTGTCCCCTCATGG + Intronic
1200647121 Y:5799323-5799345 GTGATGGGCCTTTCCCTTCAAGG + Intergenic
1201158774 Y:11153607-11153629 GTGGAGGCCCAGTCCCCACCTGG + Intergenic