ID: 1070528486

View in Genome Browser
Species Human (GRCh38)
Location 10:77315753-77315775
Sequence CAGTGCCACCCATTGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070528482_1070528486 5 Left 1070528482 10:77315725-77315747 CCAAAGAAGTGCTGCCTTTATTA 0: 1
1: 0
2: 1
3: 15
4: 154
Right 1070528486 10:77315753-77315775 CAGTGCCACCCATTGGCAGTGGG No data
1070528478_1070528486 15 Left 1070528478 10:77315715-77315737 CCCCACACCACCAAAGAAGTGCT 0: 1
1: 1
2: 0
3: 14
4: 181
Right 1070528486 10:77315753-77315775 CAGTGCCACCCATTGGCAGTGGG No data
1070528483_1070528486 -9 Left 1070528483 10:77315739-77315761 CCTTTATTAGAATGCAGTGCCAC 0: 1
1: 0
2: 0
3: 12
4: 189
Right 1070528486 10:77315753-77315775 CAGTGCCACCCATTGGCAGTGGG No data
1070528477_1070528486 16 Left 1070528477 10:77315714-77315736 CCCCCACACCACCAAAGAAGTGC 0: 1
1: 0
2: 3
3: 17
4: 221
Right 1070528486 10:77315753-77315775 CAGTGCCACCCATTGGCAGTGGG No data
1070528479_1070528486 14 Left 1070528479 10:77315716-77315738 CCCACACCACCAAAGAAGTGCTG 0: 1
1: 0
2: 3
3: 11
4: 173
Right 1070528486 10:77315753-77315775 CAGTGCCACCCATTGGCAGTGGG No data
1070528480_1070528486 13 Left 1070528480 10:77315717-77315739 CCACACCACCAAAGAAGTGCTGC 0: 1
1: 0
2: 2
3: 16
4: 177
Right 1070528486 10:77315753-77315775 CAGTGCCACCCATTGGCAGTGGG No data
1070528481_1070528486 8 Left 1070528481 10:77315722-77315744 CCACCAAAGAAGTGCTGCCTTTA 0: 1
1: 0
2: 1
3: 8
4: 157
Right 1070528486 10:77315753-77315775 CAGTGCCACCCATTGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070528486 Original CRISPR CAGTGCCACCCATTGGCAGT GGG Intronic
No off target data available for this crispr