ID: 1070529727

View in Genome Browser
Species Human (GRCh38)
Location 10:77326006-77326028
Sequence TCCCCCCCATTTCTAAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070529723_1070529727 16 Left 1070529723 10:77325967-77325989 CCTTATTATCCAGGATGGGGGTT 0: 1
1: 0
2: 0
3: 19
4: 167
Right 1070529727 10:77326006-77326028 TCCCCCCCATTTCTAAGGACAGG No data
1070529714_1070529727 28 Left 1070529714 10:77325955-77325977 CCTTTGCCCAACCCTTATTATCC 0: 1
1: 0
2: 1
3: 15
4: 140
Right 1070529727 10:77326006-77326028 TCCCCCCCATTTCTAAGGACAGG No data
1070529724_1070529727 7 Left 1070529724 10:77325976-77325998 CCAGGATGGGGGTTGACTGTTTT 0: 1
1: 0
2: 1
3: 3
4: 119
Right 1070529727 10:77326006-77326028 TCCCCCCCATTTCTAAGGACAGG No data
1070529722_1070529727 17 Left 1070529722 10:77325966-77325988 CCCTTATTATCCAGGATGGGGGT 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1070529727 10:77326006-77326028 TCCCCCCCATTTCTAAGGACAGG No data
1070529713_1070529727 29 Left 1070529713 10:77325954-77325976 CCCTTTGCCCAACCCTTATTATC No data
Right 1070529727 10:77326006-77326028 TCCCCCCCATTTCTAAGGACAGG No data
1070529717_1070529727 21 Left 1070529717 10:77325962-77325984 CCAACCCTTATTATCCAGGATGG 0: 1
1: 0
2: 2
3: 14
4: 205
Right 1070529727 10:77326006-77326028 TCCCCCCCATTTCTAAGGACAGG No data
1070529716_1070529727 22 Left 1070529716 10:77325961-77325983 CCCAACCCTTATTATCCAGGATG 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1070529727 10:77326006-77326028 TCCCCCCCATTTCTAAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070529727 Original CRISPR TCCCCCCCATTTCTAAGGAC AGG Intronic
No off target data available for this crispr