ID: 1070537178

View in Genome Browser
Species Human (GRCh38)
Location 10:77388321-77388343
Sequence CAGCCCCACCAGGAGCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070537178_1070537182 12 Left 1070537178 10:77388321-77388343 CCACAAAGCTCCTGGTGGGGCTG 0: 1
1: 1
2: 2
3: 18
4: 249
Right 1070537182 10:77388356-77388378 CTCTCCTGCTGATTTCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070537178 Original CRISPR CAGCCCCACCAGGAGCTTTG TGG (reversed) Intronic
900169106 1:1257639-1257661 CACCCCCACCAGGAGCAGAGGGG + Intronic
900229148 1:1547521-1547543 AAGCCCCACCAGAGGCTGTGAGG + Intronic
900792630 1:4690202-4690224 CAGACCCTCCAGGAGGTTTGTGG + Intronic
901477005 1:9496724-9496746 CAGCCCCAGCATGATATTTGTGG + Intergenic
902491135 1:16781506-16781528 CAGCTACACCTGGAGCTCTGGGG + Intronic
902573386 1:17361149-17361171 CAGCCCCACCTGGGGCTCCGGGG + Intronic
904937251 1:34140451-34140473 CAGCCTCACCAAGAGCTTCAAGG + Intronic
905119731 1:35672459-35672481 CAGCCCCACCCTGGACTTTGTGG - Intergenic
905751427 1:40467980-40468002 CAACCCCAGCAGGAGATTGGAGG + Intergenic
906286001 1:44588284-44588306 CAGCCCCAGCAGGAGAGATGCGG - Intronic
906788261 1:48635334-48635356 CAGTCCCTCCAGGGGCATTGAGG - Intronic
909731144 1:78891631-78891653 CGGCACCACCTGGATCTTTGGGG - Exonic
910398537 1:86815052-86815074 CAGCTCCATCAGGTGCTTTAAGG - Intergenic
912453171 1:109779930-109779952 CAGGGCCACCTGGAGCTCTGAGG - Intergenic
917791917 1:178504449-178504471 CAGTTCCAGCAGGAGCTCTGGGG - Intergenic
919814098 1:201426847-201426869 CAGCCCCACATGAAGGTTTGTGG + Intronic
919929065 1:202209300-202209322 CAGCCCCTCCAGGATCCCTGGGG - Intronic
920066313 1:203272462-203272484 CAGCCCCTCCAGGATCATAGGGG - Intronic
921190461 1:212703779-212703801 CAGCCCCACCAGGAGCCCGCAGG - Intergenic
921413333 1:214860194-214860216 CAACCCAACCAGAGGCTTTGTGG - Intergenic
922797563 1:228348286-228348308 CGGCCCTGACAGGAGCTTTGGGG + Intronic
922927655 1:229363744-229363766 CAGCCCCACCTCCAACTTTGGGG - Intergenic
923529308 1:234801028-234801050 CAGCTACACCTGGAGCTCTGGGG - Intergenic
924078747 1:240369953-240369975 CCACCTCACCAGTAGCTTTGGGG - Intronic
924677373 1:246193495-246193517 CAGCCCCAGCAGTGGCCTTGTGG + Intronic
1063819755 10:9820317-9820339 CAGCAGCAGCAGGAGCTTGGTGG - Intergenic
1064344945 10:14523514-14523536 CAGCCGGACCAGGAGGTGTGTGG - Intronic
1064769613 10:18710532-18710554 CAGCCGCAGCAGGAGCTTCCCGG - Intergenic
1064958620 10:20938737-20938759 CAGCTCCATCAGGTCCTTTGAGG - Intronic
1065164280 10:22958616-22958638 CTGCCCCACCACTTGCTTTGTGG + Intronic
1065287758 10:24202038-24202060 CAGCCACACCTGGAGCTGAGGGG - Intronic
1065995893 10:31059149-31059171 GATCCCCACAAGGAGATTTGGGG + Intergenic
1066060345 10:31718517-31718539 CAGCTCCACCAGGTCCTTTAAGG + Intergenic
1066475003 10:35738394-35738416 CAGACCAACCAGGAGCACTGGGG - Intergenic
1066496772 10:35949752-35949774 CAGGCCCAGTAGGGGCTTTGGGG + Intergenic
1067280257 10:44865548-44865570 CAGCCCCACGGGGATCTTTCTGG - Intergenic
1068620554 10:59176886-59176908 CAGCCCCACCAGCCCCTGTGAGG + Exonic
1069754332 10:70764043-70764065 CTTCTCCACCAGGAGCTTTCAGG - Intergenic
1070537178 10:77388321-77388343 CAGCCCCACCAGGAGCTTTGTGG - Intronic
1070723760 10:78774255-78774277 AAGCCCCACCGTGAGCTTGGAGG + Intergenic
1070932878 10:80273378-80273400 CAGGCCCACAAGGAGCCCTGAGG + Exonic
1071668987 10:87589524-87589546 CAACCCCATAAGGAGCTCTGGGG + Intergenic
1071999075 10:91176748-91176770 CAGCTCCACCAGGTCCTTTAAGG + Intronic
1073251433 10:102122097-102122119 CACCCCCACCAGGAGCAGAGAGG + Intergenic
1076098136 10:127750171-127750193 CAGCCCCATCAGGAGACTCGTGG + Intergenic
1076316909 10:129548722-129548744 CAGTCCCACCTGCAGCTTTCGGG + Intronic
1076595144 10:131620499-131620521 CACCCCCACCAGGCCCTTTCTGG - Intergenic
1077057132 11:599667-599689 CAGCCCCACCAGCAGCCCTGTGG + Intronic
1077109090 11:854252-854274 CCGCAGCACCAGGAGCTTGGTGG + Intronic
1078317922 11:10307450-10307472 CGGCCCGCCCAGGAGCCTTGGGG + Intergenic
1079237596 11:18701109-18701131 CAGCGCCACCCGCATCTTTGTGG + Exonic
1081531131 11:43959996-43960018 GGCCCCCACCAGGAGCTTTTTGG + Intergenic
1082141655 11:48616598-48616620 CAGCTCCATCAGGTCCTTTGAGG + Intergenic
1082144317 11:48648690-48648712 CAGCTCCATCAGGTGCTTTAAGG + Intergenic
1083235860 11:61350359-61350381 CTGCACCACCAGGAGCTCTTGGG + Exonic
1083864998 11:65448873-65448895 GAGCCCCACCAGGAGCAGTCTGG - Intergenic
1085306710 11:75490478-75490500 CAGCCCATCCACCAGCTTTGTGG - Intronic
1085516759 11:77116158-77116180 CAGCCCCACCAGAATCTGTCTGG - Intronic
1086874070 11:92073819-92073841 CAGCTCCATCAGGTGCTTTAAGG - Intergenic
1089498355 11:118919043-118919065 CACCCCCACCAGGACTTCTGTGG + Intronic
1089630096 11:119779114-119779136 CAGCCCTTCCAGGAGCTGAGAGG - Intergenic
1089648326 11:119894942-119894964 CAGCCCCACCCCGACCCTTGTGG + Intergenic
1090533444 11:127615080-127615102 GAGGCCCACGGGGAGCTTTGGGG - Intergenic
1092137975 12:6162875-6162897 CACCACCACCAGAAGCTTTCAGG + Intergenic
1092202956 12:6598294-6598316 CCGCCCCTCCAAGGGCTTTGGGG + Exonic
1094172245 12:27505723-27505745 TGACCCCACCAGGAGCTCTGCGG - Intergenic
1096686113 12:53289319-53289341 CTGCCCCAGCAGGAGTCTTGGGG - Intronic
1098846286 12:75539439-75539461 CAGCCCCATCAGCACCCTTGAGG + Intergenic
1101524749 12:105518706-105518728 CAGCTCCATCAGGTCCTTTGAGG + Intergenic
1102602212 12:114039955-114039977 CAGCCCAGCCAGGACCTTTGAGG - Intergenic
1104503705 12:129310517-129310539 AAGCCCCAGCAGGAGCTCAGAGG - Intronic
1105624709 13:22101586-22101608 CAGCCCCACTAGTAACTCTGTGG - Intergenic
1107017311 13:35717965-35717987 CAGCCTCACCAGGAGCCCAGAGG + Intergenic
1110001615 13:70210004-70210026 CAGCTCCATCAGGTCCTTTGAGG - Intergenic
1112509756 13:99998458-99998480 GAGCCCCACCAGGCGCTGTCAGG - Intergenic
1113208208 13:107941861-107941883 CAGCACCACCAGGCTCTCTGAGG - Intergenic
1113503683 13:110798447-110798469 GAGCCACACTAGGAGCGTTGAGG + Intergenic
1113698300 13:112364462-112364484 CAGCCCCGCCAGGTGCTGAGAGG + Intergenic
1113821109 13:113213818-113213840 CTGCCCCACCAGGGGATATGTGG + Intronic
1113878843 13:113611244-113611266 CACACACACCAGTAGCTTTGTGG + Intronic
1120378993 14:83749028-83749050 CCTCCCCACCACCAGCTTTGAGG + Intergenic
1121881355 14:97503171-97503193 CAGGACCACCAGGAGTGTTGGGG + Intergenic
1124658726 15:31528204-31528226 CAGCCCCACGAGGAGAGGTGAGG + Intronic
1129392904 15:75229417-75229439 CCGCACCACCAGGTGCTTCGGGG + Intergenic
1130199379 15:81810775-81810797 CTGGACCAGCAGGAGCTTTGTGG - Intergenic
1131532586 15:93206433-93206455 AAGCCCCACCAGGAGCAGTGGGG - Intergenic
1132180921 15:99752396-99752418 CAGGCACACCAGGACCTTTTGGG + Intergenic
1132405833 15:101541464-101541486 CAGCCCCACCAGGAGCCTTGGGG - Intergenic
1132616136 16:841990-842012 CAGCCCAACCTTCAGCTTTGGGG + Intergenic
1132622147 16:872875-872897 CAGAACCATCAGGAGCTTTGAGG + Intronic
1132847711 16:2008118-2008140 CACGCCCTCCAGGAGCTCTGTGG - Intronic
1134036572 16:11035940-11035962 CTGGCCCAGAAGGAGCTTTGGGG + Intronic
1134402557 16:13923150-13923172 CAGCCCCTACATTAGCTTTGGGG - Intronic
1134762054 16:16723168-16723190 CAACTCCACAAGGAGCTCTGGGG - Intergenic
1134984004 16:18636002-18636024 CAACTCCACAAGGAGCTCTGGGG + Intergenic
1136652959 16:31688476-31688498 CAGCTCCATCAGGTCCTTTGAGG - Intergenic
1138511420 16:57510629-57510651 CAGGGTCACCAGGAGCTCTGGGG - Intergenic
1140535586 16:75706063-75706085 CATGCCCACAAGGAGCCTTGAGG + Intronic
1141116125 16:81311314-81311336 CAGCACCAGGAGGAGCTTTCTGG + Intergenic
1141716513 16:85730087-85730109 CAGCTCCCCCAGGGGCTCTGAGG - Intronic
1141742779 16:85905108-85905130 CTGCCCCACCAGGAGATATTTGG - Intronic
1143355833 17:6327772-6327794 CAGCCTCTCCAGAACCTTTGGGG - Intergenic
1143393371 17:6573564-6573586 CAGCCCCAGCAGGAGTGTAGGGG + Intergenic
1146229271 17:31094558-31094580 CAGCCTCCCCAGGAGATTAGCGG + Intergenic
1147610423 17:41798806-41798828 CAGCCCCACCTGGAGCAGAGGGG + Intergenic
1147679000 17:42227520-42227542 CACACCCACCTGGAGCTGTGTGG + Exonic
1147679022 17:42227622-42227644 CAGGCCCTCCAGGAGCTGGGTGG + Exonic
1147686640 17:42289907-42289929 CAGGCCCTCCAGGAGCTGGGTGG - Exonic
1148820377 17:50356448-50356470 CAGCCCCACCATGCCCTCTGGGG + Intronic
1150648044 17:66992148-66992170 CCCCCCCCCCAGGAGCTTGGCGG - Intronic
1156019953 18:32588589-32588611 CAGTGACACCAGGAGCTATGGGG - Intergenic
1158416145 18:57251314-57251336 CAGTCCCATGAGGAGCTCTGAGG - Intergenic
1160678672 19:403878-403900 CAAATCCACCAGGAGCTTTTGGG - Intergenic
1161322625 19:3648409-3648431 CAGCCGCACCAGCAGCTCTCGGG - Intronic
1161345557 19:3767284-3767306 CAGCTCCTCCAGGGTCTTTGGGG - Exonic
1161659966 19:5539912-5539934 CAGCCCCACAAGGGGCATGGAGG + Intergenic
1162152336 19:8655383-8655405 CAGCCCCACCAGGAGGGTACAGG - Intergenic
1163637986 19:18446219-18446241 CATCGCCACCACGAGCTTGGTGG - Intronic
1163639371 19:18452662-18452684 CAGCCCCACCAGCAGTGATGAGG - Intronic
1165530359 19:36394691-36394713 GAGCCCAATCAGGAGATTTGTGG - Intronic
1166070419 19:40384035-40384057 CAGCCCCAGCAGGATCTCAGGGG + Exonic
1166952508 19:46438961-46438983 AGTCCCCACCAGGAGCTTTGAGG - Intergenic
1166952703 19:46440375-46440397 AGTCCCCACCAGGAGCTTTGAGG - Intergenic
1167432361 19:49461842-49461864 CAGCCGCAGGAGGAGCCTTGCGG - Intronic
926150826 2:10424794-10424816 CAGTCCCCGGAGGAGCTTTGAGG - Intronic
926925949 2:17987962-17987984 CAGCTCCATCAGGTCCTTTGAGG + Intronic
927001633 2:18800981-18801003 TAGCCTGACCTGGAGCTTTGGGG - Intergenic
927417850 2:22897573-22897595 CAGCCCCACAATGAGCCATGTGG + Intergenic
932380309 2:71276412-71276434 CCGCCCCACCAGGAGCGGTCTGG - Intergenic
934250350 2:90347885-90347907 AAGCCCCACCAGCAACATTGGGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
937124365 2:119464012-119464034 CAGCCTCAGCAGGGGCTTGGGGG + Intronic
937992771 2:127673683-127673705 CAGCCCCAGCAGCAGCATTGAGG - Intronic
938718596 2:134044039-134044061 CAGCCCCATCAGGTCCTTTAAGG - Intergenic
940804620 2:158172999-158173021 CAGCCCCTCCAGGAGCTCTTAGG + Intronic
943549443 2:189320465-189320487 CAGCCCCATCAGGTCCTTTAAGG - Intergenic
944669221 2:201981324-201981346 CAGCCAAACCAGAAGCTTGGCGG + Intergenic
946074342 2:217061644-217061666 TATCCCCACCAGGGGCTTTTTGG - Intergenic
946249617 2:218404565-218404587 CAGCCCCACCAGGCGGTGTAGGG + Exonic
946309681 2:218876450-218876472 CCTCCCCACCATGAGCCTTGAGG - Intergenic
947344619 2:229178019-229178041 CAGCCCCAGCAGCAGCTTACAGG + Intronic
947731072 2:232432120-232432142 CAGCCCCACGGGGAGCTGAGTGG + Intergenic
948193157 2:236075630-236075652 GAAGCCCCCCAGGAGCTTTGAGG + Intronic
948686427 2:239672895-239672917 CATCCCCACCAGGATCTTGATGG + Intergenic
948923347 2:241077859-241077881 CAGTCCCACCAGCAGCGTAGAGG - Intronic
949021001 2:241741405-241741427 CATCCTCAGCAGGTGCTTTGGGG + Intronic
1169778929 20:9288004-9288026 CAGCTCCACCAGCAGGATTGTGG + Intronic
1171231398 20:23489696-23489718 CTGCCTCACCAGGAACTTTCTGG + Intergenic
1172052208 20:32126644-32126666 CATGCCCACAAGGAGCTTTCAGG - Intronic
1172811597 20:37652025-37652047 CAGGCCCACCAGGAGAATGGAGG - Intergenic
1173563933 20:44025954-44025976 CCACCCCGCCAGGAGCTTTAGGG - Intronic
1173595728 20:44257605-44257627 CCCCCCCACCAGGAGCAGTGGGG + Intronic
1174985174 20:55443691-55443713 AAGCCCCAGCAGGAGATTTGAGG + Intergenic
1176045936 20:63092574-63092596 CTGCCCCACGTGGGGCTTTGAGG + Intergenic
1176063806 20:63183818-63183840 CAGGCCCACCTGGACCTTGGTGG - Intergenic
1178496968 21:33094954-33094976 GAGTCCCACCAGCAGCTGTGAGG + Intergenic
1178499778 21:33116087-33116109 CAGCTCCACATGGAGCTCTGCGG + Intergenic
1180187454 21:46146489-46146511 CTGCCCCGCCAGGAGCCCTGTGG + Intronic
1181760039 22:25052011-25052033 CAGCTCCCCCAGCAGCTGTGTGG - Intronic
1182157132 22:28084810-28084832 CAGCTCCATCAGGTCCTTTGAGG - Intronic
1182691349 22:32165681-32165703 CAGCCCCACCAGGCCCTCTTAGG - Intergenic
1183574072 22:38675855-38675877 CAGCACCATTAGGACCTTTGGGG + Intergenic
1183599618 22:38832364-38832386 CTGCCCCAGCAGGAGCTGAGTGG - Intronic
1183694787 22:39415583-39415605 CTGGCCCAGCAGGAGCTCTGCGG - Exonic
1184741069 22:46429408-46429430 CAGCCACGCCGGGAGGTTTGGGG - Intronic
1184762362 22:46551739-46551761 CGGACCCAAAAGGAGCTTTGTGG + Intergenic
1185222110 22:49634285-49634307 AGACCCCACCAGGAGCCTTGGGG - Intronic
949877512 3:8635790-8635812 CAGTCTCTCCAGGAGCTCTGTGG + Exonic
950364127 3:12471213-12471235 CAGCCTCAGCAGGAGCGATGTGG - Intergenic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
952407308 3:33015934-33015956 ATGCCCCACCAGGTGCTTTGGGG - Intronic
954070670 3:48140750-48140772 CAGCCCTACCAGCTCCTTTGAGG + Intergenic
954083348 3:48225178-48225200 GGGCCCCCGCAGGAGCTTTGGGG - Intronic
954445909 3:50546828-50546850 CAGCTCCCCCAGGAGCCTGGAGG + Intergenic
955030351 3:55210415-55210437 CAGCTCCATCAGGTCCTTTGAGG - Intergenic
959103601 3:102041208-102041230 CAGCTCCATCAGGACCTTTAAGG - Intergenic
961003755 3:123391048-123391070 CTGCCCCTCCAGGGGCTTGGGGG + Intronic
961361575 3:126371322-126371344 CAGCTCCAGCAGGACCTCTGTGG - Intergenic
961643931 3:128382386-128382408 CGGCACCAGCAGGAGCTGTGTGG + Intronic
962437456 3:135380183-135380205 CAACCCCATGGGGAGCTTTGGGG - Intergenic
962846494 3:139278633-139278655 CTGCCACAGCAGGAGCTTTCTGG - Intronic
963900230 3:150726533-150726555 CAGCCACACCAGCAGGTTTCTGG - Intergenic
966861572 3:184233573-184233595 CAGCCCCACCAGCTGCTTCGGGG + Exonic
967856493 3:194121665-194121687 CAGCCCCACCAGCACCTCGGAGG + Intergenic
968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG + Intergenic
969158108 4:5231039-5231061 CAACCCCACGGGGAGCTCTGGGG - Intronic
969490718 4:7497853-7497875 GAGGACCAGCAGGAGCTTTGTGG + Intronic
973861148 4:55066257-55066279 ACGTCCCACCAGGAGCTGTGTGG - Intergenic
975205414 4:71639335-71639357 CCACCCCACTAGGAGCTATGTGG + Intergenic
976260367 4:83139612-83139634 CAGCCTCCCCAAGAGCTTAGAGG + Intergenic
976493459 4:85698822-85698844 CAGCCCCACCTCCAGCATTGGGG - Intronic
977666093 4:99649281-99649303 TGGCACCACCATGAGCTTTGTGG - Exonic
978186441 4:105861401-105861423 CAGCTCCATCAGGTCCTTTGAGG - Intronic
980231406 4:130051043-130051065 CAGCTCCATCAGGTCCTTTGAGG + Intergenic
982621385 4:157710305-157710327 CAGCCCCACCTCCAGCATTGAGG + Intergenic
982966026 4:161909217-161909239 GATCCCCACCAGGAGCTCTGTGG + Intronic
985358660 4:189148105-189148127 CTGCCACACCAGCAGATTTGTGG - Intergenic
985845188 5:2339330-2339352 CTGTCCCTCCAGGGGCTTTGGGG + Intergenic
987258291 5:16179563-16179585 CGGCACAACCATGAGCTTTGAGG - Exonic
989843515 5:46111058-46111080 CAGCTCCACCAGGTCCTTTAAGG + Intergenic
991939457 5:71836616-71836638 CAGCCCAACAATGAGCTTTATGG - Intergenic
992157400 5:73968875-73968897 CAGCCCCATCCAGGGCTTTGTGG - Intergenic
992354682 5:75968475-75968497 CAGCTCCATCAGGTCCTTTGAGG - Intergenic
993305350 5:86269880-86269902 CAGCTCCATCAGGTGCTTTAAGG + Intergenic
995682274 5:114733056-114733078 CAGCCACATCCAGAGCTTTGTGG - Intergenic
995712223 5:115047537-115047559 CAGTCCCACAAGGAGCTGGGAGG + Intergenic
996114268 5:119600611-119600633 CAGCTCCATCAGGTCCTTTGAGG - Intronic
998054388 5:139061975-139061997 CAGCCCTATTAGGAGCTTGGAGG - Intronic
998058233 5:139097257-139097279 CAGCTCCCCCAGGTGCTATGTGG - Intronic
998331437 5:141331317-141331339 CACCCCCATCAGAAGCTGTGAGG - Exonic
998850951 5:146350183-146350205 CAGCCCCATCAGTAGGTCTGGGG + Intergenic
999320970 5:150614842-150614864 CAGCAACCCCAGGAGCTGTGGGG + Intronic
1005747260 6:28849742-28849764 CAGCTCCATCAGGTCCTTTGAGG - Intergenic
1007414747 6:41684820-41684842 CAGCCACAGCCTGAGCTTTGGGG - Exonic
1011376604 6:86694219-86694241 CAGCTCCACCAGGTCCTTTAAGG + Intergenic
1012844832 6:104375892-104375914 CAGCTCCATCAGGTCCTTTGAGG - Intergenic
1016414665 6:143820143-143820165 CAGCCCCACCTCCAGCATTGGGG + Intronic
1022456053 7:30559401-30559423 CTGCCCCACCAAGATCTCTGAGG + Intergenic
1023818992 7:43969917-43969939 CAGCCCTACCAGGCACCTTGAGG + Intergenic
1023972559 7:45001990-45002012 AAGCCAGACAAGGAGCTTTGGGG + Intronic
1024687177 7:51758647-51758669 CAGCCCCACCTCCAGCATTGGGG + Intergenic
1025595045 7:62913702-62913724 CAGCTCCATCAGGACCTTTAAGG + Intergenic
1026036335 7:66832910-66832932 CAGCCCTACCCGCAGCTTTGAGG - Intergenic
1026681096 7:72467259-72467281 CAGCCCCACCAGCAGGATTGGGG - Intergenic
1027348455 7:77286382-77286404 CAGCCCCACCACCAACGTTGGGG + Intronic
1028231191 7:88307685-88307707 CAACCCCACAAGAAGCTATGAGG - Intergenic
1029744045 7:102506880-102506902 CAGCCCCACCAGGCACCTTGAGG + Intronic
1029762035 7:102606043-102606065 CAGCCCCACCAGGCACCTTGAGG + Intronic
1034934054 7:155187245-155187267 CAGCCCGGCCAGGTGCTTAGGGG - Intergenic
1035368364 7:158362853-158362875 CAGTCCCATCTGGGGCTTTGGGG - Intronic
1037204540 8:16299435-16299457 CATCCCCACCAGCAACTTCGTGG - Intronic
1040073170 8:43204705-43204727 CTGCCCCACCAGGAACGTTCCGG + Intergenic
1040985056 8:53285009-53285031 CAGCCCCAGCAGCTGCTTTTCGG + Intergenic
1043519426 8:81027989-81028011 CAGCCCCAACAGCAGCTGTGGGG - Intronic
1047254930 8:123207491-123207513 CAGCCCCACCAAGGCCCTTGGGG + Exonic
1048576395 8:135693534-135693556 CAACCCCACCAGGAGCTCTGAGG + Intergenic
1049396229 8:142402533-142402555 CATCCCCACCAGGGACTTTCAGG - Intronic
1050309289 9:4336320-4336342 CAGCAGCACCAGGGGCTTAGTGG - Intronic
1051519237 9:17966103-17966125 GAGGCCCACCAGGAGCTTCTTGG + Intergenic
1052799532 9:32955495-32955517 CAGCCCCACTAGAAGCTTTGAGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053391871 9:37741672-37741694 GAGCCCCATCAGGCCCTTTGAGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054965628 9:71023877-71023899 CATCCCCACAAGGACCTTTTGGG - Intronic
1056581681 9:87891145-87891167 CGGGCCCACCAGAAGCTTTCAGG - Intergenic
1058305698 9:103438376-103438398 CAGCTCCATCAGGTCCTTTGAGG + Intergenic
1061489188 9:130935820-130935842 CAGCCACCCTAGGAGCTTGGTGG - Intronic
1061958349 9:133975228-133975250 CTCCCCCACCAGGAGCTAGGAGG + Intronic
1062386395 9:136313331-136313353 CAGCCCCCGCAGGAGCTTCTTGG + Intergenic
1062606956 9:137352772-137352794 CTGCCCCACCAGGCCCTGTGAGG + Exonic
1187022268 X:15396288-15396310 CAGCACCACCATGAACTGTGAGG - Intronic
1190271614 X:48868548-48868570 CAGCTCCACCAGGTCCTTTAAGG + Intergenic
1191180531 X:57558596-57558618 CAGCTCCATCAGGAACTTTAAGG + Intergenic
1192508427 X:71705886-71705908 GAGACACCCCAGGAGCTTTGGGG + Intergenic
1192512217 X:71728828-71728850 GAGACACCCCAGGAGCTTTGGGG - Intergenic
1192514480 X:71752677-71752699 GAGACACCCCAGGAGCTTTGGGG + Intergenic
1192518269 X:71775667-71775689 GAGACACCCCAGGAGCTTTGGGG - Intergenic
1192527148 X:71857001-71857023 GAGACACCCCAGGAGCTTTGCGG + Intergenic
1192825512 X:74692179-74692201 CAGCTCCATCAGGACCTTTAAGG + Intergenic
1195787828 X:108546951-108546973 CAGCCCCATCAGGTCCTTTAAGG + Intronic
1196019255 X:110972863-110972885 CAGCTCCATCAGGTCCTTTGAGG - Intronic
1198554293 X:137776393-137776415 CAGCCCCTGTAGGAGCTATGTGG + Intergenic
1199605935 X:149579774-149579796 CAACCCAACCAGGAGCTTATGGG + Intergenic
1199633186 X:149789594-149789616 CAACCCAACCAGGAGCTTATGGG - Intergenic
1200209230 X:154338980-154339002 CAGCCTCACCAGCACCTTTTGGG - Intergenic
1200221646 X:154393149-154393171 CAGCCTCACCAGCACCTTTTGGG + Intronic