ID: 1070537592

View in Genome Browser
Species Human (GRCh38)
Location 10:77391260-77391282
Sequence ATCCTTCCCTGGGGCATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070537592_1070537601 28 Left 1070537592 10:77391260-77391282 CCCTTGATGCCCCAGGGAAGGAT 0: 1
1: 0
2: 2
3: 19
4: 151
Right 1070537601 10:77391311-77391333 AAGCAAGCTTCCGCTCACAGAGG No data
1070537592_1070537598 -8 Left 1070537592 10:77391260-77391282 CCCTTGATGCCCCAGGGAAGGAT 0: 1
1: 0
2: 2
3: 19
4: 151
Right 1070537598 10:77391275-77391297 GGAAGGATGTGTGCCCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070537592 Original CRISPR ATCCTTCCCTGGGGCATCAA GGG (reversed) Intronic
900164521 1:1239437-1239459 ATCCGTCCCCGGTGCCTCAAGGG - Intergenic
900434670 1:2623752-2623774 CTCCATCCCTGGGCCACCAAGGG - Intronic
901802363 1:11715639-11715661 ATCCTTCCCTGGGACATGCTGGG - Intronic
902275468 1:15336565-15336587 TTCCTTCCCTTTGCCATCAAAGG + Intronic
902381515 1:16054956-16054978 CTCTGGCCCTGGGGCATCAATGG - Intronic
902583324 1:17423040-17423062 CTCCTTCCCTGGGGCAGCAGCGG + Intronic
907582352 1:55583644-55583666 ATCCTTCCATGGTACAGCAAAGG + Intergenic
909239914 1:73199345-73199367 AGCTTTTCCAGGGGCATCAAAGG + Intergenic
912642780 1:111363010-111363032 ATCGTTCCCTGGAGCACCATAGG - Intergenic
912706466 1:111918723-111918745 ATACTTCCTTTGGGCAACAAAGG - Intronic
915565756 1:156711675-156711697 ACACATCCCTGGGGGATCAAAGG + Intergenic
917266100 1:173222560-173222582 TTCCTTCCCTGGGCCCTCATAGG + Intergenic
920006379 1:202836495-202836517 ATCCTTCCATGGGGGACCACAGG + Intergenic
921349543 1:214221642-214221664 ATCTTTTCCTGGCCCATCAAAGG + Intergenic
922208164 1:223467034-223467056 ATCCTTCCATGAGGCACCACTGG - Intergenic
922556122 1:226533654-226533676 ATTCTTCCTTGGGTCATTAAAGG + Intergenic
1062974146 10:1671317-1671339 ATCCTTTCCTGGGGCAACCGTGG - Intronic
1063540492 10:6928701-6928723 AGCCTTCCATGGGGAAGCAACGG - Intergenic
1064272126 10:13875016-13875038 CTCCTTCCCTGGGGTATTGACGG - Intronic
1064308810 10:14193067-14193089 ATTCTACCCTGGGCCATCCATGG + Intronic
1069606907 10:69744460-69744482 CTCCTTCCCTGGGGAATCCAAGG + Intergenic
1069827189 10:71261509-71261531 ATCCTTCCCTGAGACGTCAGTGG + Intronic
1070537592 10:77391260-77391282 ATCCTTCCCTGGGGCATCAAGGG - Intronic
1071233071 10:83611712-83611734 CTCCTTCCCTGGGTCATAAATGG - Intergenic
1073899043 10:108197883-108197905 TTTCTTCCCTGGGGCATTGATGG + Intergenic
1076156157 10:128207172-128207194 ACCCTTCCCCTGGGCATCATAGG + Intergenic
1079116428 11:17643331-17643353 CTCCTGCCCTGGGGCATCACGGG + Intronic
1079355944 11:19730435-19730457 ATCCTGCCCTGGAGCCTCAATGG - Intronic
1079920396 11:26427087-26427109 AACCTTCCCTGCTTCATCAAGGG + Intronic
1080089420 11:28327098-28327120 GTACTTCTCTGGGGGATCAAAGG - Intronic
1081684811 11:45034822-45034844 ATCCTTCCCAGTGGCAGCAGTGG - Intergenic
1083711673 11:64553588-64553610 ATCTTTCCCAGGTGCCTCAAGGG - Intergenic
1089183349 11:116597943-116597965 ATCCTTCCCTGTCTCAGCAAGGG - Intergenic
1089560624 11:119341424-119341446 ATCCTTCTCTGGGGCTCCCAGGG - Exonic
1090082213 11:123621445-123621467 ATCCTTCCCTTGTGCACCCAGGG - Intronic
1092553869 12:9534229-9534251 AAGATTCTCTGGGGCATCAAAGG - Intergenic
1092635055 12:10435825-10435847 ATCCTTCCCTGAATCATCAAGGG - Exonic
1094518225 12:31156387-31156409 AAGATTCTCTGGGGCATCAAAGG + Intergenic
1099371015 12:81829807-81829829 ATTCCTCCCTGGTGCATCCAGGG - Intergenic
1102930386 12:116857587-116857609 CTCCCTCCCTGGGGCATTAGAGG - Exonic
1104168656 12:126258468-126258490 ACCCTCCCCTGTGGCAGCAAGGG + Intergenic
1104180602 12:126376712-126376734 AACATGCCCTGGGGCATCATGGG - Intergenic
1106181785 13:27375760-27375782 ATCCTTGCCTGGGCCAACTATGG - Intergenic
1107079331 13:36357436-36357458 ATCCTTACCAGGGGCCTCAGGGG - Intronic
1107090847 13:36477425-36477447 ATCCTACCCTGGAGCTTGAAAGG + Intergenic
1110808307 13:79784314-79784336 CTCTTTCCCTGGAGCATAAAAGG - Intergenic
1111172097 13:84541042-84541064 ATCCTTCCCTCAGTTATCAAAGG - Intergenic
1113506292 13:110818960-110818982 ATCCTTTCCTGTGGCCTCAGGGG - Intergenic
1113601444 13:111572105-111572127 ATCCCTTCCTGGGGCCTCAAGGG + Intergenic
1114922818 14:27355779-27355801 ATCCTTCCCTGCAGCATTTAAGG - Intergenic
1118045835 14:61970243-61970265 TTCCTTTCCTGGAGCATCGAGGG + Intergenic
1118669429 14:68106822-68106844 ATCAATGCCTGGGGCATAAAAGG - Intronic
1121988299 14:98529447-98529469 ATGCATCAGTGGGGCATCAAAGG + Intergenic
1122119683 14:99545510-99545532 TTCCTTCCCTGTGCCTTCAAGGG + Intronic
1122166563 14:99829232-99829254 ATCCTTTCCTGTGTCATCCAGGG + Intronic
1124154723 15:27215804-27215826 ATCCATCCCTGGGACTACAAAGG - Intronic
1125190328 15:36985221-36985243 ATCCTTCTCTGGACCATCATGGG + Intronic
1125469600 15:39990026-39990048 ATAGTTCCCTGTGGCATCCAAGG - Intronic
1127671352 15:61197888-61197910 ATCCCTCCCAGGGGGTTCAAGGG + Intronic
1128805236 15:70526004-70526026 ATCTATGCCTGGGGCATCAAGGG + Intergenic
1129297897 15:74609834-74609856 AACATGCCCTGAGGCATCAACGG - Intronic
1132666255 16:1082589-1082611 GTCCTTCCCTGGGGCAGCATGGG - Intergenic
1132701589 16:1224507-1224529 CTCCTTCCCTGGGGTCCCAATGG - Intronic
1132896966 16:2233768-2233790 TGCCTTCCCTGGGGCCACAAGGG + Intronic
1137754448 16:50890199-50890221 ATCATCCCCTTGGGCAGCAAGGG - Intergenic
1141031518 16:80592839-80592861 ATCCTTCTCTGGGAAAGCAAAGG + Intergenic
1141276093 16:82589527-82589549 AGCCTTCACTGGGGCTTCACTGG + Intergenic
1142151568 16:88514722-88514744 AGTCCTCCCTGGGGCACCAAAGG - Intronic
1145270056 17:21400149-21400171 ACCCTTCCCTGTGGCCTGAAGGG + Intronic
1145993168 17:29091279-29091301 GTCCTTCCCTGGGGCCTGAAGGG - Intronic
1147449296 17:40493884-40493906 ATCCAGTCCTGGGGCATGAACGG + Intronic
1148216200 17:45835160-45835182 TTGCTGCCCTGGGGCATCATGGG + Exonic
1150077634 17:62206743-62206765 CTCCTCCCCAGGGGCACCAAAGG - Intergenic
1151382832 17:73737337-73737359 ACCCTTCCCTGGAGCCTCCAGGG - Intergenic
1151672017 17:75576050-75576072 ACCCTCCCCTGGGGAAACAAGGG - Intergenic
1151824025 17:76513565-76513587 ATCCTTCCCAGAGGCTTCAGAGG + Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1154497430 18:14972568-14972590 AGCTCTCCCTGGGGCATCCATGG + Intergenic
1156371590 18:36476298-36476320 ATCTTTCCCAGGGGCATGGAAGG + Intronic
1158546162 18:58399144-58399166 ATCCTTCCTCGGGCCAACAAGGG - Intronic
1166650479 19:44570562-44570584 ATCCCTCCCTGGGCCGTCGAGGG - Intergenic
925994796 2:9283475-9283497 CTCCTTCCCTGAGGCTTCAGGGG + Intronic
938413152 2:131082137-131082159 ATCCATCCCTGGGCCACAAAGGG - Intronic
939965559 2:148606988-148607010 ATGCCTCCCTGGGGCTTCACGGG + Intergenic
942183819 2:173405548-173405570 ATCCTCCCCTGGGCCACCTAGGG - Intergenic
944628391 2:201596265-201596287 ATCCTTTCCAGGGGCATGGATGG + Intronic
944677587 2:202047172-202047194 TTCCCTCCCTGGGGCATCCTGGG + Intergenic
945064162 2:205934380-205934402 ATCCTCCCCTGAGCCATCGAGGG + Intergenic
946284038 2:218689167-218689189 ATATTTCCCTGTGGCAACAATGG - Intronic
947523773 2:230866354-230866376 AGTCTTGCCTGGGGCATTAAGGG + Intronic
947531321 2:230910370-230910392 CTCCTTCCCATGGGCATCATGGG - Exonic
947617763 2:231569241-231569263 CTCCTCCCCTGGGGCACCCAAGG - Intergenic
948033419 2:234838424-234838446 ATCCTTCCCTTGGTCATCTCCGG - Intergenic
948783798 2:240340562-240340584 ATCCTTCCCTGCGGCACCCCGGG - Intergenic
1169338466 20:4776764-4776786 ATCCTTCCCTGGGACAACCCAGG - Intergenic
1173690972 20:44960578-44960600 CTCCTTCCCTGCGTCATCCACGG - Intergenic
1174107702 20:48174591-48174613 ATCCTTTCCTGGGGAAATAAAGG - Intergenic
1174609864 20:51790275-51790297 CACTTTCCCTGGGGCATCTAAGG + Exonic
1175945679 20:62557712-62557734 ATCCTGCCCGGGGGCATCAAAGG - Intronic
1176117423 20:63439173-63439195 GCCCTGCCCTGGGGCAACAAGGG + Intronic
1176307513 21:5131633-5131655 ATCCAGCCCTGGGGCAGCAAAGG + Intronic
1179473861 21:41631062-41631084 ATCCTTCCCTGGGACAGCCCAGG - Intergenic
1179480134 21:41671758-41671780 AGACTTCCCTGGGGCATGAAAGG + Intergenic
1179849547 21:44130397-44130419 ATCCAGCCCTGGGGCAGCAAAGG - Intronic
1180129855 21:45820464-45820486 ATCCTGACCTGGGTCATCACAGG - Intronic
1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG + Intergenic
1182086601 22:27565330-27565352 ATGATTTCTTGGGGCATCAAAGG - Intergenic
1184038990 22:41932489-41932511 ATCCTTGCCTGGGTCTTCATGGG + Intergenic
1185314561 22:50173449-50173471 ACCCTGCCCTGCGGCATCAGGGG - Intronic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
949562350 3:5214380-5214402 GACCTTCACTGGGGCATTAACGG - Intronic
950307926 3:11930584-11930606 ATCTTTCCCTAAGGCGTCAATGG + Intergenic
960573852 3:119210312-119210334 TCCCTGCACTGGGGCATCAAAGG - Intergenic
965376004 3:167925055-167925077 ATCCTTCATTTGGGCAACAAGGG - Intergenic
965741059 3:171874983-171875005 ACCCCACCCTGGGGCCTCAAAGG + Intronic
968220134 3:196931347-196931369 AGTGTTCCCTGGGGCATTAAGGG + Exonic
969286065 4:6202524-6202546 ATCCTTCCCCAGGGCTTCATAGG + Intergenic
970162083 4:13199163-13199185 CTCCTTCCCTGAAGCATAAATGG + Intergenic
971240193 4:24881409-24881431 CTCCTTCCCTGCAGCAACAATGG + Intronic
972130267 4:35824363-35824385 ATGCTTCCCTGCCGCAACAATGG + Intergenic
973701302 4:53539912-53539934 GTCCTTGCATGGGGCATCCATGG + Intronic
973839635 4:54847979-54848001 ATCCTTCCCTCAGGCTTGAATGG - Intergenic
975487504 4:74950303-74950325 ATCCTCCCCTGGAGCTTCAGAGG - Intronic
977429329 4:96911757-96911779 CTTCTTCACTGGGGCATAAAAGG + Intergenic
978319309 4:107476816-107476838 CTTCTTCACTGGGGCATTAAGGG + Intergenic
980469688 4:133234658-133234680 ATACTTCCCTGTGAAATCAAGGG + Intergenic
981309809 4:143286315-143286337 ATCTATCCCTGGGACGTCAAAGG + Intergenic
984648075 4:182240894-182240916 ATCCTGCCCAGGGGCCTCAGAGG - Intronic
987058067 5:14214284-14214306 ACCCTTCCTTGGGGCCTGAAGGG - Intronic
988029014 5:25738893-25738915 ATCCTGCCCTGGAGCACCACAGG + Intergenic
988709897 5:33762691-33762713 ATTCTTCCCTGGAGCATGATAGG + Intronic
993658949 5:90606659-90606681 ACCCTTCCCTGGAGAATGAATGG - Intronic
993984002 5:94575010-94575032 GAACATCCCTGGGGCATCAATGG + Intronic
995897733 5:117034269-117034291 CTCCTTCTCTGGGGCAGCCATGG - Intergenic
999358130 5:150956666-150956688 TTCCTCACCTTGGGCATCAATGG - Intergenic
999694803 5:154179393-154179415 ATCCTGCCCTGGCTCCTCAAGGG + Intronic
1001909881 5:175507074-175507096 ATCCTTCCTTGGGGCTTCCAAGG + Intronic
1003196819 6:3921841-3921863 GACCTTCCCTTGGGCATCATGGG - Intergenic
1003555626 6:7137263-7137285 CTCCTTCCCTGGGGGCTCAGGGG - Intronic
1006296515 6:33172343-33172365 ATCCTTCCCTGGGGCCCCAGGGG + Exonic
1011746729 6:90413652-90413674 ATCCTTCCCTCTGGCACCAAAGG - Intergenic
1011927713 6:92668552-92668574 AGCCTTCCCTAGTACATCAAAGG - Intergenic
1013515108 6:110877475-110877497 ATCCTTCCCTGGGGTCTCTGGGG - Intronic
1015126995 6:129765994-129766016 TTCTTTCTCTGAGGCATCAAAGG - Intergenic
1015207410 6:130655560-130655582 AGCCTTCTCTTGGGCATCATTGG - Intergenic
1016756511 6:147693446-147693468 GTCCTGCCCTGGGGCAATAAGGG + Intronic
1017613278 6:156213995-156214017 ATCCTGCCCTGGGGCTCCACTGG - Intergenic
1018580422 6:165303169-165303191 ATCCTTCCCTGAGTCAACCAAGG + Intronic
1019599251 7:1873289-1873311 GTCCTGTCCTGGGGCCTCAATGG + Intronic
1019997586 7:4734607-4734629 CTCCCTCCCTGGGGCTTCATGGG + Intronic
1020731316 7:11884561-11884583 ATCCTTTCCAGGGACATGAATGG + Intergenic
1022718897 7:32924898-32924920 ATCGTTGCCTAGGGCATCAATGG + Intergenic
1023284355 7:38603782-38603804 ACACTTCCCTGAGGCCTCAAAGG + Intronic
1023735727 7:43234529-43234551 ATTCTTCCCTTGGGCAGGAATGG + Intronic
1030221722 7:107105570-107105592 ATCCTTGCCTGCTACATCAAGGG + Intronic
1030930594 7:115519608-115519630 AGTCTTCCCTGGGGCATGAGTGG - Intergenic
1031130104 7:117823641-117823663 ATCCTTGGCTGGGGCATCAAAGG - Intronic
1040634874 8:49261207-49261229 ATGCTTCCCTGGGGCTTTGATGG + Intergenic
1042825419 8:72974699-72974721 ATACTTCCATGTGGCATGAATGG + Intergenic
1046461554 8:114543676-114543698 ATCCTTCTCTGGGGTATCTATGG + Intergenic
1047771188 8:128031279-128031301 AGCAGCCCCTGGGGCATCAAAGG - Intergenic
1049750780 8:144282635-144282657 TTCCTTCCCTGGGGTATCTGTGG - Intronic
1051369377 9:16345299-16345321 TTCTTTTCCTGGGGCATGAAAGG + Intergenic
1057171021 9:92963190-92963212 ATACTTCACAGGGGCATGAAGGG + Intronic
1059119323 9:111627803-111627825 ATCGTTCCCTGGGGCAAGGAAGG + Intergenic
1060161419 9:121369100-121369122 TTCCTTCCCAGGAGCATCAAAGG - Intronic
1060778939 9:126397795-126397817 ATCCTTTCCTAGGTCTTCAATGG - Intronic
1062395746 9:136351936-136351958 ATACATCCCTGGGGCGTCAGTGG + Intronic
1188405237 X:29799801-29799823 ATTGTTCCCTGGGGCATTACAGG + Intronic
1192797228 X:74434125-74434147 TTCCTTCTCTGGTGCATCCAAGG - Intronic
1193227038 X:78995899-78995921 CTTCTGCCCTGGGGCATCACAGG - Intergenic
1199112178 X:143947838-143947860 ATCCTTCCATGGATCATTAAGGG + Intergenic
1199848978 X:151711798-151711820 TTCCTTCCCTGGGCCAGCTATGG + Intergenic