ID: 1070539686

View in Genome Browser
Species Human (GRCh38)
Location 10:77407169-77407191
Sequence CCAGTCCTGCTTCCCACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070539686_1070539693 -8 Left 1070539686 10:77407169-77407191 CCATGTGTGGGAAGCAGGACTGG No data
Right 1070539693 10:77407184-77407206 AGGACTGGGAGGAGTGATGGGGG No data
1070539686_1070539692 -9 Left 1070539686 10:77407169-77407191 CCATGTGTGGGAAGCAGGACTGG No data
Right 1070539692 10:77407183-77407205 CAGGACTGGGAGGAGTGATGGGG No data
1070539686_1070539694 19 Left 1070539686 10:77407169-77407191 CCATGTGTGGGAAGCAGGACTGG No data
Right 1070539694 10:77407211-77407233 ATTTAAAGCCTGATGCCAGCCGG No data
1070539686_1070539691 -10 Left 1070539686 10:77407169-77407191 CCATGTGTGGGAAGCAGGACTGG No data
Right 1070539691 10:77407182-77407204 GCAGGACTGGGAGGAGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070539686 Original CRISPR CCAGTCCTGCTTCCCACACA TGG (reversed) Intronic