ID: 1070541805

View in Genome Browser
Species Human (GRCh38)
Location 10:77420817-77420839
Sequence AAGCTGAGATGGAGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 0, 2: 6, 3: 73, 4: 623}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070541805 Original CRISPR AAGCTGAGATGGAGAGAAGT GGG (reversed) Intronic
900433286 1:2612821-2612843 AGGGTGGGATGGAGAGAAGAGGG + Intronic
900555639 1:3279050-3279072 AAGTTGACATGGAGAGAAACTGG - Intronic
900772126 1:4553683-4553705 AAGATGGGATGGAGAGATTTGGG - Intergenic
901011096 1:6202570-6202592 ATGATGAGATGGAGGGCAGTTGG - Intronic
901193554 1:7426718-7426740 AATCTGAGATTCAGAGACGTGGG + Intronic
901635346 1:10667856-10667878 CAGCCGAGATGGGGAGAAGGTGG - Intronic
902108627 1:14059232-14059254 AAGCTGGGAAAGAGAGAAGCTGG + Intergenic
902171610 1:14616023-14616045 AAGCTGGGGTGGAGAGAAGGTGG + Intronic
902373600 1:16019751-16019773 GAGGTGAGATGGAGAGAGGGTGG + Intronic
902404702 1:16176224-16176246 ATGATGAGATGGAGAGAGATAGG - Intergenic
902952081 1:19892957-19892979 ATGCTGAGATGGAGAGGTGGAGG - Intronic
903064562 1:20691925-20691947 TAGCAAAGATGGAGAGAAGTGGG - Intronic
903169606 1:21543966-21543988 GAGCTGAGGTGGAGAGAGCTTGG + Intronic
904092665 1:27956138-27956160 AAGCTGAGAGTGAGGGAAGGTGG - Intronic
904292650 1:29497804-29497826 AAACTGGGAGGGAGAGAAGGAGG + Intergenic
904599664 1:31666474-31666496 AAGATGAGAAGGAGAGAGGGAGG - Intronic
904956239 1:34286299-34286321 AAGCCCAGATGGGGAGAAGAGGG - Intergenic
904970536 1:34416131-34416153 TAGCTGAGATTGAGAGGACTGGG + Intergenic
905094404 1:35456841-35456863 AAGGAGAGATGGAGGGAAGGAGG + Intronic
905337680 1:37256724-37256746 GAGGAGAGATGGAGAGAAGGAGG - Intergenic
905386553 1:37608248-37608270 AAGATGCGATGCAGAGAAGCGGG + Intergenic
905450382 1:38052249-38052271 GAGCTTAGAGGGAGAGACGTAGG - Intergenic
906257305 1:44360092-44360114 AAGCTGCGATTGAGAGGAGGGGG - Intergenic
906471842 1:46137574-46137596 AAGATCAGATGCAGAGAAGTAGG - Intronic
906566896 1:46807298-46807320 TAGCTGATAAGGAGGGAAGTGGG + Intronic
906916750 1:50020506-50020528 AAGGTGAAATGGAAAGAAATGGG - Intronic
907528640 1:55070549-55070571 CTGCTGAGTTGGAGAGAAGAGGG + Intronic
907774182 1:57497063-57497085 AAGCTGATATGGAAAGAATCAGG - Intronic
908338700 1:63154216-63154238 GAGCTGAGATAGAGAAAATTTGG + Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909405020 1:75279178-75279200 AGGGAGAGATGAAGAGAAGTTGG - Intronic
909622745 1:77685486-77685508 AAGCTGAACTGGGCAGAAGTTGG - Intergenic
909845663 1:80390725-80390747 AAGGGGAGATAGAGAGAAGTTGG + Intergenic
910368289 1:86489250-86489272 AAGATGGGATGGAGAGAGATAGG + Intronic
910451768 1:87354260-87354282 AAACTGAGATTTAGAAAAGTTGG + Intergenic
910576410 1:88769811-88769833 AAGAAGAAATGGGGAGAAGTTGG + Intronic
910967063 1:92818445-92818467 ATACTTAGATGGAAAGAAGTAGG + Intergenic
911093573 1:94037423-94037445 AAGGGGAAGTGGAGAGAAGTAGG - Intronic
911624861 1:100111729-100111751 AAGCTGAAAAGGAGAGGAGAAGG + Intronic
911737503 1:101353871-101353893 AAGGAGAGATAGAGAGAAGAAGG - Intergenic
912204476 1:107494800-107494822 AAGGGGAGATGGAGTGAAGAGGG - Intergenic
912393195 1:109319152-109319174 AAGCTAAGAGGAACAGAAGTGGG - Intronic
913708626 1:121455453-121455475 AAGCTGAAGAAGAGAGAAGTTGG - Intergenic
914191912 1:145419221-145419243 AAGTAGGGAAGGAGAGAAGTAGG + Intergenic
914949652 1:152101561-152101583 AAGAGGAGATGGGTAGAAGTAGG - Intergenic
915112009 1:153569899-153569921 AATCAGAGATGGGGAGAAGATGG - Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
916175564 1:162035374-162035396 AAGGTGAGTGGGAGAGGAGTGGG + Intergenic
916429827 1:164717102-164717124 AAACTGAGATGCAGAGAAAATGG - Intronic
916536973 1:165712554-165712576 GAGCTGAGAGGGAGAGAAATGGG - Intergenic
916994274 1:170279311-170279333 AAGCAGGGATGAAGAGAGGTAGG + Intergenic
917063260 1:171063982-171064004 GAGGAGAGATGGAGAGAAGGGGG + Intronic
917089509 1:171338478-171338500 TGGATGAGATGGAGAGCAGTAGG - Intronic
917243312 1:172973122-172973144 AAGATGGGATGGAGAGATGATGG - Intergenic
917971213 1:180209025-180209047 AAACTGAGATTTAGAAAAGTTGG - Intergenic
918107366 1:181426243-181426265 GACTTGAGATGGAGAGAGGTTGG - Intronic
918427083 1:184421558-184421580 AAGCTGAGGTGGAAAAACGTGGG - Intronic
918507062 1:185267306-185267328 GAGCTGAGATACAGAGAAGTAGG + Intronic
919083852 1:192897045-192897067 AAGGGGAGATGGGGAGAGGTTGG + Intergenic
919158879 1:193803050-193803072 GAATTGAGATGGAGAGGAGTTGG + Intergenic
919439184 1:197606787-197606809 AAGATGAGATGAAGAGACTTAGG + Intronic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
920067928 1:203282295-203282317 AAGCTGGGAGGGAGGGCAGTGGG - Intergenic
920073336 1:203319243-203319265 AAGGTGAGCAGGAGAGAATTCGG - Intergenic
920199204 1:204249172-204249194 GAGCTGAGAAGGTGAGAAGCTGG - Exonic
920292439 1:204933277-204933299 AAGGTGAGATGGGGAGAATGCGG + Intronic
920622937 1:207566272-207566294 AAGGGGAGAAGGAGAGAAGAAGG - Intronic
920635617 1:207699620-207699642 AAGGAGAGAGGGAGAGAAGAAGG - Intronic
921049908 1:211503944-211503966 TAGCTGAGGTTCAGAGAAGTTGG - Intergenic
921188680 1:212691228-212691250 AAGGTGAGAAAGAAAGAAGTAGG + Intronic
921216910 1:212945548-212945570 AAGCTGAGAGGCATAGGAGTAGG - Intergenic
921319975 1:213929289-213929311 ATGCTGAGATGGCAAGAAGAGGG - Intergenic
921415773 1:214884952-214884974 AAGCTGAGATGGCCAGAGCTAGG - Intergenic
923437967 1:233986293-233986315 AACTTGGGGTGGAGAGAAGTTGG - Intronic
923549798 1:234954527-234954549 AAGCAGAGATGGAGAGCTGGCGG - Intergenic
923737913 1:236629381-236629403 AAACTGAGATCCAGAGAGGTTGG - Intergenic
924016761 1:239734806-239734828 AACCCAAGATGGAGAGAAGTAGG + Intronic
924668804 1:246102352-246102374 GATCTGAGATGTAGAGAAGAAGG - Intronic
1063422208 10:5921993-5922015 TATCTGAGATGGAGAGAATGAGG - Intronic
1063517376 10:6710336-6710358 AAGCTGAGGGAGAGAGAAGAAGG + Intergenic
1065367989 10:24953159-24953181 GAGCGGAGGTGGAGAGAGGTGGG - Intergenic
1066258570 10:33706002-33706024 AATCTGAGATGCAGAGAATGGGG - Intergenic
1067098846 10:43320259-43320281 GAGCTGAGATGGATGGATGTTGG - Intergenic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1068014723 10:51501525-51501547 AAGCACAGATGGAGAGAGCTTGG - Intronic
1068054340 10:51992508-51992530 AAGCTCAGATGAAGGGAAGTGGG - Intronic
1068519887 10:58066467-58066489 CAGGTGGGATGAAGAGAAGTGGG - Intergenic
1068559716 10:58500074-58500096 ATGTTGGGATGGAGAGAATTAGG - Intergenic
1068650798 10:59520357-59520379 AAGGTGAGAGGGTGAGAAGGGGG - Intergenic
1068723401 10:60273129-60273151 AAACTGAGATGCACAGAATTAGG + Intronic
1068760286 10:60700070-60700092 AAGCTGACTGGGAGAGGAGTGGG - Intronic
1068797051 10:61094886-61094908 AAGCTGAGAGTGCCAGAAGTTGG + Intergenic
1068798181 10:61107559-61107581 AAGCTGAGAGGTAGAAAAGGAGG + Intergenic
1069639327 10:69944769-69944791 AACCTGAGATGGACACAAGGTGG - Intronic
1069785285 10:70983900-70983922 AAGCTGGGATGGACGGAAGTGGG + Intergenic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070328842 10:75404158-75404180 AAGCTCATTTGGAGAGAAGAGGG + Intergenic
1070496200 10:77025707-77025729 AATGTGAGAGGGAAAGAAGTGGG + Intronic
1070515173 10:77198419-77198441 ATGCTGAGATGAAGAAAAGATGG - Intronic
1070541805 10:77420817-77420839 AAGCTGAGATGGAGAGAAGTGGG - Intronic
1070682234 10:78456700-78456722 AAGCAGAGAGGGAGACAACTTGG + Intergenic
1070751176 10:78964912-78964934 AGGCTGTTCTGGAGAGAAGTAGG + Intergenic
1071415542 10:85437615-85437637 AGGCCGACATGGAGAGAAGCTGG - Intergenic
1072256971 10:93630264-93630286 AAGCCCTGATGGGGAGAAGTGGG - Intronic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1073325710 10:102643244-102643266 GAGCAGAGGTGGAGAGAAATCGG + Intergenic
1073941888 10:108708823-108708845 AAGCTTAGCAGGACAGAAGTGGG - Intergenic
1074159782 10:110828109-110828131 AAGCTGGGATGGATAGAGGAGGG - Intronic
1074866216 10:117545701-117545723 AAGCTGGGACGGGGAGAAGGCGG - Exonic
1074933251 10:118151202-118151224 AAGCTGAGAGACAGAGATGTTGG + Intergenic
1075825680 10:125355615-125355637 AGGCAGAGAAGGTGAGAAGTGGG + Intergenic
1075850375 10:125581562-125581584 AAGCTGACTCTGAGAGAAGTAGG - Intronic
1076083392 10:127604063-127604085 AAGCTGAGAGGGATAGTAGCTGG - Intergenic
1076436398 10:130447081-130447103 AAGCAAAGATGGAAAGAAGAGGG - Intergenic
1076598145 10:131638472-131638494 AGGGTGAGATGGGGAGAGGTGGG - Intergenic
1076632339 10:131858579-131858601 ATGCTGAGCAGGAGAGATGTGGG + Intergenic
1077480489 11:2812310-2812332 AAGCAGAGAGGGAGGGAAGGAGG - Intronic
1078096657 11:8301502-8301524 AGGCTGAGAAGCAGAGCAGTAGG - Intergenic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078734664 11:14008947-14008969 AGGCTGAGAAGGGGAGAAGTTGG - Intronic
1079042758 11:17073905-17073927 AATCTGATATGGAGAGACATTGG - Intergenic
1080135084 11:28844759-28844781 AAGGAGAGAAGGAGAGAAGGAGG - Intergenic
1080607404 11:33875108-33875130 AAGCTCAAATGCAGAGAGGTTGG - Intronic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1081075938 11:38673753-38673775 AAGTTGAGAAGGAGAGAAGGTGG - Intergenic
1081342873 11:41949327-41949349 AAGCAGAGAAGGACAGATGTAGG + Intergenic
1081357488 11:42130342-42130364 AAGCTGGGATGGTAAGAAGGGGG - Intergenic
1081686549 11:45047091-45047113 AACCCTAGATGGAGAGATGTAGG - Intergenic
1081699212 11:45142246-45142268 AAGCAGATGTGGGGAGAAGTGGG - Intronic
1083487016 11:62989651-62989673 AAGCAGCAATGGAGAGAAGGAGG + Intronic
1083795912 11:65016588-65016610 TTGCTGAGATGGAGAGGACTGGG + Intronic
1085014962 11:73167909-73167931 TAGGAGAGAGGGAGAGAAGTGGG + Intergenic
1085198603 11:74687759-74687781 CAACAGAGAGGGAGAGAAGTGGG - Intergenic
1085407617 11:76272719-76272741 CAGGTGTGATGGAGAGAGGTGGG - Intergenic
1087592964 11:100215684-100215706 AAGCAGAAATGAAGAGAAGCTGG + Intronic
1087619787 11:100528420-100528442 AAGCTGAAATGGAAAAAAGCTGG + Intergenic
1088202241 11:107350947-107350969 AAGCTGAGATGATGAGAGGAAGG + Intronic
1088821265 11:113459644-113459666 AGGGGGAGATGGAGAGAGGTTGG + Intronic
1089096180 11:115921948-115921970 AGGCTGAGATGGAAAGAAGAAGG + Intergenic
1089815487 11:121169992-121170014 AAGCTGGGATGAAGAGAGGTTGG - Intronic
1090747983 11:129722359-129722381 AGGCTGAGGAGGAGAGGAGTGGG + Intergenic
1091073434 11:132591056-132591078 AATCTGAGCAGGAGAGAAGACGG - Intronic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091745920 12:2992735-2992757 TGGCTGGGATGGGGAGAAGTTGG + Intronic
1091990795 12:4954263-4954285 AGGCTGATATTGAGAGAAGTGGG - Intergenic
1092028215 12:5261057-5261079 AAGCAGAAGTGGAGAGAAGAGGG + Intergenic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092669436 12:10846695-10846717 AACCTGAGATGGAGAGTCCTTGG + Intronic
1093761216 12:22913792-22913814 AAGTTGAGCTGGAGACAAGAAGG - Intergenic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1095360646 12:41334502-41334524 AAGCTGATTTGGAGATAAGGAGG - Intronic
1095445496 12:42278163-42278185 GAACTGAGAAGGAGAGAACTTGG - Intronic
1097242331 12:57583999-57584021 AGTCTGAGAAGCAGAGAAGTAGG + Intronic
1097284732 12:57868755-57868777 AAGCTGAGATGGAGGGAAAGGGG - Intergenic
1097496439 12:60343250-60343272 AACCTGAGACAGAGAGAATTAGG - Intergenic
1097515389 12:60598028-60598050 AAAATGAGAGGGAGAGTAGTGGG - Intergenic
1097634174 12:62102054-62102076 AAGCTGAGGTGGAGAGCAGGTGG + Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1097982587 12:65750000-65750022 AAGCTGAAAGGGAGATAGGTTGG + Intergenic
1098036635 12:66309832-66309854 AAGCAGATATGTAGAGAAGATGG + Exonic
1098804780 12:75009849-75009871 AAGTTCAGATGGAGAAGAGTTGG + Intergenic
1099161204 12:79243854-79243876 AAGGTGAGATGGAAGGAAGGAGG + Intronic
1099167016 12:79319374-79319396 AAGCTGAAACTCAGAGAAGTTGG + Intronic
1099300154 12:80883127-80883149 AGGATGAGAAGGAGAGAGGTAGG - Intronic
1099802712 12:87476900-87476922 AAGCAGAGATGGAGGGATGGAGG - Intergenic
1101172724 12:102116181-102116203 AAGATGAGAGAGGGAGAAGTTGG - Intronic
1101210447 12:102530211-102530233 AAGCAGTGATGGAGAGGAGGAGG - Intergenic
1101460832 12:104891371-104891393 AAGCTGAGATGGAAATTATTAGG + Intronic
1101733357 12:107444568-107444590 AAACTGAGATCAAGGGAAGTTGG + Intronic
1102569133 12:113816797-113816819 AAGCTCAGTGGAAGAGAAGTGGG + Exonic
1102646348 12:114406324-114406346 AAGCAGAGATGGATGGAGGTTGG - Intronic
1102723162 12:115035082-115035104 AAACTGAGATTCAGGGAAGTCGG - Intergenic
1102983894 12:117263692-117263714 AGGCTGAGAAGGAGAAGAGTTGG + Intronic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103074940 12:117974499-117974521 AAGGTGAGATGGAGATCAGGAGG - Intergenic
1103232657 12:119344906-119344928 AAGCTGACATTGAAGGAAGTAGG - Intronic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104923372 12:132302892-132302914 GAGCTGAGAGGGAGAGAGGAGGG + Intronic
1105042652 12:132972698-132972720 AAGCAGAAATGGAGAGGAGGAGG - Intergenic
1105686255 13:22785129-22785151 AGGGTGAGATGGGGAGATGTTGG + Intergenic
1106670428 13:31899020-31899042 AGGATGGGATGGAGAGAGGTAGG - Intergenic
1106705909 13:32279302-32279324 AATATGAGATGAAGAGGAGTGGG + Intronic
1106867045 13:33976427-33976449 GAGCAGAGATGAGGAGAAGTTGG + Intergenic
1107317542 13:39149995-39150017 AAGTAGAGAAGGAAAGAAGTCGG + Intergenic
1107346558 13:39467829-39467851 AAGGTGAGATGGGGAGAATATGG - Intronic
1107483170 13:40802223-40802245 AAGCTGCTAAGGAGTGAAGTGGG + Intronic
1107605970 13:42057339-42057361 ATAGTGAGATGGAGAAAAGTAGG - Intronic
1107618860 13:42203549-42203571 AATCTGATATGGAGGGAAGATGG - Intronic
1107715336 13:43194063-43194085 AAACTGAGATAGAGACAAGGAGG - Intergenic
1107763629 13:43709600-43709622 AAGATGAGGAGGAGAGAAGGAGG + Intronic
1107783661 13:43932498-43932520 AAAGTGTGATGGAGAGAAGTTGG + Intergenic
1107922187 13:45220650-45220672 AAGCCGAGATGGACAGAAAAAGG + Intronic
1108417772 13:50217655-50217677 AAGCTGAGGAGGAGAGAAAAAGG - Intronic
1108427086 13:50313333-50313355 AAGAAGAGAGGGAGGGAAGTGGG + Intronic
1108492873 13:50998930-50998952 AAACTGAGATGGAAGCAAGTGGG - Intergenic
1108510959 13:51155580-51155602 GAGCAGAGATTGAGAGAGGTGGG - Intergenic
1110445490 13:75575225-75575247 ACGGTGGGATGGAGAAAAGTAGG - Intronic
1111174167 13:84571645-84571667 AAGGCAAGAAGGAGAGAAGTAGG - Intergenic
1112162320 13:96881168-96881190 GAGCTGAGATGCAGAGCAGAGGG - Intergenic
1113016205 13:105831025-105831047 AAGCTGAGAAGGATAGTAGAAGG - Intergenic
1113360084 13:109622694-109622716 AAGCTGGGCTGCACAGAAGTAGG + Intergenic
1113492477 13:110703338-110703360 GAGCTGAGATGGGGAGAGGGAGG + Intronic
1115091714 14:29584932-29584954 AATTTGGGGTGGAGAGAAGTCGG - Intronic
1115141746 14:30179614-30179636 GAGGAGAGATGGAGAGAACTAGG + Intronic
1115356665 14:32454912-32454934 AAGCAGGGAAGGAGAGAAGGAGG - Intronic
1115713310 14:36074230-36074252 ATGCTGTTATGAAGAGAAGTGGG + Intergenic
1115734014 14:36303922-36303944 AGTCTGAGTTGGAGAGAAATTGG - Intronic
1115795887 14:36935275-36935297 AAGTTGAGATGGAAAGATATGGG - Intronic
1115888939 14:38005518-38005540 AAGGTGAGATGGGAAGAAGGTGG - Intronic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117660589 14:58000325-58000347 AGGCTGGGATGGAGAGAAAAGGG - Intronic
1119294835 14:73524588-73524610 AAGCTGAGGTTCAGAGAGGTAGG + Intronic
1119422969 14:74518500-74518522 ACGCTGGGTTGGAGATAAGTGGG - Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1120540281 14:85742514-85742536 AAGATGGGATGCAGAGTAGTGGG - Intergenic
1120545769 14:85809406-85809428 AAGTGGAGATGTAGAGAGGTAGG + Intergenic
1120682358 14:87495584-87495606 AGGCTGAGATGGTGAGAGGATGG - Intergenic
1202885147 14_KI270722v1_random:98909-98931 AAAAAGAGAGGGAGAGAAGTTGG - Intergenic
1123982781 15:25619259-25619281 AAGCTGGAGTGGAGAGAAGCAGG - Intergenic
1124429411 15:29593459-29593481 CAGCTGAGATGGAGTGGACTGGG - Intergenic
1124657355 15:31518931-31518953 AAGCTGAGATGGAAGGACGGGGG + Intronic
1125098646 15:35884281-35884303 AAGGAGAGATGAAGAGAGGTTGG - Intergenic
1126320641 15:47419041-47419063 AAGCTGGAAAGGAGAGAAGAGGG + Intronic
1127126792 15:55819757-55819779 AAGCTGGGATGCAGAGATGTAGG - Intergenic
1127771327 15:62233656-62233678 GAGCTGAGTGGGAGAGAAGAAGG - Intergenic
1127864392 15:63020008-63020030 AAGCTGAGAAGCTGAGGAGTTGG - Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1129650915 15:77488278-77488300 AAAGTGAAATGAAGAGAAGTTGG - Intergenic
1130251214 15:82301384-82301406 TAGGTGAGATGGAGAGAGGGAGG - Intergenic
1130924669 15:88375941-88375963 AAGGAGGGATGGAGAGAAGGAGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131867864 15:96731303-96731325 GAGTTGAGATGGGGAGAGGTGGG - Intergenic
1132159314 15:99523065-99523087 AAGCAGGGATGGAAAGAGGTGGG + Intergenic
1133054275 16:3137717-3137739 TATCTGAGCTCGAGAGAAGTGGG + Intronic
1133261181 16:4551338-4551360 AAGCTGAGCTGTAGGGGAGTGGG - Intergenic
1133848432 16:9478927-9478949 AGGTTGAGAGGAAGAGAAGTGGG - Intergenic
1134461948 16:14437180-14437202 AAGAACAGATTGAGAGAAGTGGG + Intronic
1134507474 16:14819876-14819898 AAGCTGAGGCTGAGGGAAGTTGG + Intronic
1134620619 16:15686332-15686354 AAACTGAGGTGCAGAGAAGGTGG + Intronic
1134695173 16:16218631-16218653 AAGCTGAGGCTGAGGGAAGTTGG + Intronic
1134791711 16:16994928-16994950 AAGCTGAGATGGAGACGCGATGG - Intergenic
1134869120 16:17635607-17635629 AAGCTGAGATCAAGGGGAGTTGG - Intergenic
1135188360 16:20334202-20334224 AAGCAAAGAAGCAGAGAAGTGGG + Intronic
1136107219 16:28038499-28038521 GAGCTGGGGTGGAGGGAAGTGGG + Intronic
1137306581 16:47206777-47206799 TAGCAGTGATGGAGAGAAATGGG - Intronic
1137377661 16:47967238-47967260 AAACAGAGACAGAGAGAAGTTGG - Intergenic
1137764813 16:50969916-50969938 AGACTAAGATGGAAAGAAGTGGG + Intergenic
1138264179 16:55647686-55647708 AAACTGAGACACAGAGAAGTAGG + Intergenic
1140816354 16:78624633-78624655 AAGCTGAGATGCTGAGAAGGGGG + Intronic
1143627391 17:8118323-8118345 ATGCTGAGATGGAGAAAAGGAGG + Intronic
1144211202 17:13017291-13017313 TAGCAGAGGTGGAGAGGAGTGGG + Intronic
1144263271 17:13543958-13543980 AAACTGAGATGAAGAGACTTTGG - Intronic
1144265670 17:13566375-13566397 AGGCTGAGGAGGAGAGAAATGGG - Intronic
1144773696 17:17773281-17773303 AGGATGAGCTGGAGAGAAGGTGG + Intronic
1144867667 17:18347304-18347326 CAGCTGGGATGGAGAGACGAGGG - Intronic
1145034138 17:19528420-19528442 AAGCTGGAATGGTGAGAACTCGG - Intronic
1145823771 17:27861030-27861052 AAGCTGAAAGGGAGAGATGAGGG + Intronic
1146278174 17:31528600-31528622 GAGCTGCGAGGGAGAGAAGCAGG - Exonic
1146506867 17:33413459-33413481 CAACAGAGAGGGAGAGAAGTGGG - Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146718114 17:35103340-35103362 AAGCAGAGAGGGAGGGCAGTGGG + Intronic
1146949603 17:36896769-36896791 AAGCTGAGGTCCAGAGAAGTGGG + Intergenic
1147056197 17:37837044-37837066 AAGCTGTGAAAGAGAGAAGCTGG - Intergenic
1147441842 17:40452420-40452442 TGGCTGAGTGGGAGAGAAGTGGG - Intronic
1148974365 17:51513979-51514001 AAGCAAAAATGGAGAGAAGGTGG - Intergenic
1149149841 17:53548425-53548447 AGGCGGAAATGGAGAGATGTTGG - Intergenic
1149520979 17:57318174-57318196 AAGGTGAGAAGGTGAGAAGGTGG + Intronic
1150213454 17:63454116-63454138 GTGCAGAGAAGGAGAGAAGTGGG - Intergenic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1151050916 17:70978240-70978262 AAGGAGAGATGGAGGGAAGAAGG + Intergenic
1151186002 17:72364371-72364393 AAGCAGAGATGGAGGGAACACGG + Intergenic
1151474436 17:74337831-74337853 GAGCTGAGCTGGAGAGGGGTGGG - Intronic
1152670367 17:81600588-81600610 AACCCGAGAAGGAGAGAAGCCGG - Intronic
1152687564 17:81702044-81702066 CAGCTGAGAAGCAGAGAAGCTGG - Exonic
1154350987 18:13583325-13583347 AAGGTGAGGTGGAGAGAGGATGG + Intronic
1155224468 18:23717295-23717317 GACCTTAGAGGGAGAGAAGTGGG + Intronic
1155292833 18:24358475-24358497 AAGCTGAGATGGAGATGAGTGGG - Intronic
1155450794 18:25960651-25960673 AAGCTGAGAGGGAGAAACTTTGG - Intergenic
1155844457 18:30688033-30688055 TAGCTGAGATGGAAAGAAGATGG - Intergenic
1157960044 18:52143324-52143346 AAACGGAGATGGAGATAGGTAGG - Intergenic
1158614694 18:58975883-58975905 AAGCTGAGATTGAGAGCTTTGGG - Intronic
1158630950 18:59113640-59113662 CAGCTGTGATGGGAAGAAGTGGG - Intergenic
1158738551 18:60112617-60112639 AGGCTGATGTGGAGAGAAATAGG + Intergenic
1159064908 18:63559062-63559084 AAGGAGAGAAGGAGAGAAGAAGG - Intronic
1159626383 18:70700149-70700171 AAGGGGAGATGGAGAGAAGCTGG - Intergenic
1159855384 18:73581765-73581787 AAGGCGAGATAAAGAGAAGTTGG - Intergenic
1159920244 18:74221265-74221287 CAGGTGAGAAGGAGAGAAGGAGG + Intergenic
1160041069 18:75346112-75346134 AAACTGAGATGGAGACGGGTCGG + Intergenic
1160367450 18:78339587-78339609 AAGGAGGGATGGAGAGAATTTGG - Intergenic
1161256130 19:3310791-3310813 AAGGAGAGATGGAGAGAGGGAGG - Intergenic
1161880188 19:6944416-6944438 AGGGAGAAATGGAGAGAAGTAGG + Intergenic
1162743331 19:12785848-12785870 AAGCAAAGAGGGAGGGAAGTGGG - Intronic
1163520616 19:17789404-17789426 AAGCTCAGAAGGAAGGAAGTAGG + Intergenic
1164649900 19:29884205-29884227 AAGGTGAGAGGGAGAGAAGGAGG - Intergenic
1165760306 19:38317216-38317238 AGTCTGAGAGGGAGAGAAGGGGG - Intronic
1167138755 19:47634636-47634658 TTACTGAGATGGAGAGAAGCAGG - Intronic
1167250191 19:48395229-48395251 AAGGTGAGATAGAGAGATGGAGG - Intronic
1167336058 19:48886622-48886644 AAGACTAGATTGAGAGAAGTGGG + Intronic
1167353582 19:48990769-48990791 AGGCAGAGCTGGGGAGAAGTGGG - Intronic
1167609037 19:50497377-50497399 AGACAGAGATGGAGAGAAATGGG + Intergenic
1167609147 19:50498070-50498092 AAACAGAGACAGAGAGAAGTGGG + Intergenic
1202660554 1_KI270708v1_random:65940-65962 AAAAAGAGAGGGAGAGAAGTTGG - Intergenic
925307159 2:2856544-2856566 AAGCTGACAAGGAGAGGAGGAGG - Intergenic
925377679 2:3399991-3400013 GTGCTGAGATGGAGAGATCTTGG + Intronic
925818743 2:7778426-7778448 AAAGTGAGAGGGAGAGAAGAGGG + Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
927644401 2:24867652-24867674 AATCAGAAATGGAGAGAATTTGG + Intronic
927904917 2:26848994-26849016 AGTCTGAGCTGGAGAGAAGCCGG + Intronic
928240744 2:29583529-29583551 AAACTGAGATCAAGAGAGGTTGG - Intronic
928301549 2:30129783-30129805 AAGCAGAGAGGGAGGGAAGGAGG - Intergenic
928781320 2:34824813-34824835 AAGATGAGATGGAGACAGGAGGG + Intergenic
930209811 2:48623903-48623925 AAGGAGAGAAGGAGAGAAGGGGG + Intronic
930699735 2:54447358-54447380 AAGTTGAGGTGCAGAGAGGTTGG - Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
931914512 2:66938692-66938714 AAGGTTAGAAGGAGAGAAATAGG + Intergenic
932412414 2:71555162-71555184 ATGCTGAGATGGGGAGAACATGG + Intronic
933320573 2:80771294-80771316 AAGGAGAGAAGGAGAGAATTAGG - Intergenic
934566263 2:95343229-95343251 CAGCTGAGATGGGGAGACTTGGG + Intronic
934936425 2:98469167-98469189 CAGCTGGGGTGGAGAGCAGTGGG + Intronic
935177236 2:100660290-100660312 AAGCAGAAATGGAGAGAAGGAGG + Intergenic
935438103 2:103058773-103058795 AAGAATAGATGGAGAGAAATGGG - Intergenic
936574419 2:113641530-113641552 CAGGTGTGATGGAGAGAACTGGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937699833 2:124851766-124851788 AAGCTGAGATTAAGAGGAGGGGG + Intronic
937789629 2:125944528-125944550 AAGGTGAGATGGATAGCAGAAGG + Intergenic
937802930 2:126101796-126101818 AAGCTGATATAAAAAGAAGTGGG + Intergenic
938764908 2:134454276-134454298 AAGCTGAGAGGGAGCGAACTTGG + Exonic
938804819 2:134796382-134796404 AAGCTGAGAAGGAGAGACTGAGG - Intergenic
939062213 2:137435919-137435941 AATGTGAGATGGAGAGAAAGTGG - Intronic
939636695 2:144590878-144590900 TAGCTGAGATGGAGATGACTAGG - Intergenic
940382008 2:153025699-153025721 CAGCAGATATAGAGAGAAGTGGG - Intergenic
941327903 2:164140820-164140842 AGGGAAAGATGGAGAGAAGTTGG - Intergenic
941590390 2:167413177-167413199 AAGCTGACAAGGAGAGAGATGGG + Intergenic
942494965 2:176530383-176530405 AAGCAGATCTGGAGACAAGTTGG - Intergenic
942545349 2:177057753-177057775 AAACTGAGACAGAGAGAAGTTGG + Intergenic
942676251 2:178429459-178429481 ATGCTGAGATGAAGATTAGTGGG + Intergenic
942954281 2:181756198-181756220 AACATGAGATGGAGAGAGGAAGG + Intergenic
943175657 2:184470086-184470108 AGGGAGAGATGAAGAGAAGTTGG + Intergenic
943924007 2:193747439-193747461 AAGCTGGGAAGGAGAGTGGTTGG + Intergenic
944457179 2:199907849-199907871 CAGTTGAGAGGGAGAGGAGTGGG - Intergenic
944775258 2:202957393-202957415 AAGATGAGTTTGAGAAAAGTAGG - Intronic
944926335 2:204468547-204468569 ATGCTGAGAGGGAGGGAAGGGGG - Intergenic
945020502 2:205566392-205566414 AAGCAGAATCGGAGAGAAGTGGG + Intronic
945485085 2:210385785-210385807 AAGATGAGATGGAGATGAGAAGG - Intergenic
945643317 2:212458757-212458779 AAGTTAAGAAGGAGAGAAGGAGG + Intronic
945712767 2:213320532-213320554 AAGGGGAGATGAAGAGAAATTGG - Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946069053 2:217015372-217015394 AAGCAGAGGTGGACAGAAGGTGG - Intergenic
946677093 2:222171707-222171729 CAGCTGAGGAGGAGAGAAGGAGG - Intergenic
947081448 2:226401356-226401378 GATCTGAGATTGAGAGAAGAGGG - Intergenic
947497990 2:230652622-230652644 AAGCTGAGATAGACCGAAATGGG - Intergenic
947805212 2:232961878-232961900 AAGCTGAAAAGCAGAGAAGCAGG + Intronic
947808376 2:232983655-232983677 GAGCTCAGAGGGAGAGAAGTTGG + Intronic
948127158 2:235572600-235572622 AAGCCCAGGTGCAGAGAAGTGGG - Intronic
948334055 2:237194006-237194028 GGGCTGAGCTGGAGTGAAGTGGG - Intergenic
948563279 2:238867830-238867852 AAGGCGGGAGGGAGAGAAGTGGG + Intronic
948879133 2:240847259-240847281 CAGCGGAGAGGGAGAGAAGGAGG - Intergenic
1168819278 20:762258-762280 AAGCTGAGTTGAAGTGAAGATGG + Intronic
1168967446 20:1907417-1907439 AAGCTGAGATGGGGAGGACCTGG - Intronic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169520297 20:6364261-6364283 AAGCTAAGATGCAGTGAGGTGGG - Intergenic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1169776461 20:9259582-9259604 TGGCAGAGATGGAGAGAAGGAGG + Intronic
1169932259 20:10846910-10846932 TAGCTAAGATGTGGAGAAGTGGG + Intergenic
1170409625 20:16074730-16074752 AAGATGAGAGGGAGAGTGGTGGG - Intergenic
1170467480 20:16636098-16636120 AAACTGAGTTTCAGAGAAGTTGG + Intergenic
1171077179 20:22139732-22139754 TTGCAGAGATGTAGAGAAGTTGG - Intergenic
1171268781 20:23797166-23797188 AGGCTGAGAAGGAAAGAAGGGGG + Intergenic
1172622979 20:36331767-36331789 ATGCTGTGATGGAGAGCAGCAGG + Intronic
1173159111 20:40639281-40639303 AAGGTCAGATGGAGAGGAGCTGG - Intergenic
1173236868 20:41254312-41254334 AAACTGAGATGCAGAGGAGCTGG - Intronic
1173409120 20:42794069-42794091 AAGCTAGGATGGAAAGAAGTGGG - Intronic
1173504933 20:43579411-43579433 AGGATGTGATGGAAAGAAGTTGG + Intronic
1173816265 20:45990873-45990895 AAACAGAGATGAAGAGAAGAAGG - Intergenic
1173831372 20:46091006-46091028 ACGCTGTGATGGAAAGAAATAGG + Intergenic
1174061601 20:47836817-47836839 AAGCAGAGATGGGGACTAGTGGG - Intergenic
1174069922 20:47892508-47892530 AAGCAGAGATGGGGACTAGTGGG + Intergenic
1174290943 20:49508084-49508106 AAGGTGTGAAGGAGAGGAGTAGG + Intronic
1174510621 20:51049265-51049287 AAGCTGTGATGGGTAGGAGTAGG + Intergenic
1174561776 20:51435831-51435853 AAGCTAAGATAAACAGAAGTTGG - Intronic
1174709468 20:52689692-52689714 AAGATGGGAAGGAGAGAAGGGGG + Intergenic
1175347828 20:58294921-58294943 AGGCAGAGAAGGAGAGAAGTGGG - Intergenic
1175572043 20:60030757-60030779 GAGCTGAGAGGGAGTGGAGTGGG + Intronic
1176685925 21:9848484-9848506 TTGCTGAGATGTAGAGGAGTGGG - Intergenic
1177662384 21:24102213-24102235 AAGCAGAGAAGGAGGGAAGAAGG + Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1178384599 21:32138875-32138897 CTGCTGAGATGGGGAGAAGTGGG + Intergenic
1178725487 21:35047791-35047813 AAGCTGAGATGGAGTGGGCTGGG - Intronic
1179205577 21:39274349-39274371 AAGTTGAGATTGTTAGAAGTAGG - Intronic
1179820011 21:43931081-43931103 AAACTGACCTGGAGAGCAGTTGG - Intronic
1180328036 22:11449528-11449550 AAAAAGAGAGGGAGAGAAGTTGG - Intergenic
1180788244 22:18558742-18558764 AAGCTGCGTTGGAGAGAGCTGGG - Intergenic
1181233494 22:21436576-21436598 AAGCTGCGTTGGAGAGAGCTGGG + Intronic
1181245156 22:21498267-21498289 AAGCTGCGTTGGAGAGAGCTGGG - Intergenic
1181922978 22:26334906-26334928 AAGGGGAGATGGAGAGATGCTGG - Intronic
1182193639 22:28491107-28491129 GAGATGGGATGGAGAGAAGCAGG - Intronic
1182950023 22:34365075-34365097 AAGATGGGATGGAGAGAAGGAGG + Intergenic
1182983171 22:34691755-34691777 AAAGGGAAATGGAGAGAAGTAGG - Intergenic
1183246541 22:36698128-36698150 AAGGAGAGAGGGAGAGAAGGGGG - Intronic
1184415250 22:44348429-44348451 AAGCTGAGGAGGAGAGAAAATGG + Intergenic
1184694383 22:46131475-46131497 AGGCTGAGGTGGAGGGAAGTGGG + Intergenic
1185197666 22:49482391-49482413 TCCCTGAGATGGAGAAAAGTTGG + Intronic
949630702 3:5923307-5923329 AAACTGAGAATAAGAGAAGTTGG + Intergenic
949823056 3:8136684-8136706 GTGCTGAGAGGGAGAAAAGTGGG + Intergenic
950035273 3:9880490-9880512 AAGCTGATATGGGGTGGAGTTGG - Intergenic
950174673 3:10864593-10864615 AAGCTGAGTTGAAGGGAAGCCGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950643677 3:14364460-14364482 AAACTGAGACTCAGAGAAGTTGG - Intergenic
951443139 3:22745953-22745975 AAGCTGACTGGGAAAGAAGTGGG + Intergenic
951490323 3:23263104-23263126 TAGCTGAGATGGAGAGCATGAGG + Intronic
952070422 3:29627779-29627801 AAGAAGAGAGGGAGAGAAGGAGG + Intronic
952227431 3:31392724-31392746 GTGCTGAGGTGGAGAGAAGTAGG - Intergenic
952243208 3:31556028-31556050 AAGCAGAGATGAAGAGAGATTGG - Intronic
953209458 3:40862859-40862881 AAGCTGAGATTCAGAGAAGAGGG + Intergenic
953453898 3:43026601-43026623 AATATGAGCTGGAAAGAAGTAGG + Intronic
955078067 3:55632459-55632481 CAGGTGAGATGGAGACAAGGAGG + Intronic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
955798487 3:62662204-62662226 AAGCTGAGAAGCAGAGAGGAGGG - Intronic
956128618 3:66034380-66034402 AAGCTGAGGTTCAGAGAATTTGG - Intronic
956267414 3:67412707-67412729 ATGCTGAGAGAGAGAGAAGGAGG - Intronic
956733529 3:72218107-72218129 AAGCTGAGAAGCTGAGAAGCTGG + Intergenic
956948931 3:74257547-74257569 CAGCTGCTAAGGAGAGAAGTTGG - Intergenic
956990496 3:74757420-74757442 GGGCTGGGATGGAGGGAAGTGGG - Intergenic
957263974 3:77936891-77936913 AAGCAGGGAGGGAGAGAGGTGGG - Intergenic
957717949 3:83956350-83956372 GATCTGAGATAGAGAGAAGGAGG - Intergenic
957953275 3:87151056-87151078 AAGTTGGTATGTAGAGAAGTGGG - Intergenic
958593066 3:96185005-96185027 AGGCAGATATGGAGAGATGTTGG + Intergenic
958743116 3:98098729-98098751 AAGGAGAGAGGGAGAGAAGGAGG - Intergenic
959089216 3:101884622-101884644 GACGCGAGATGGAGAGAAGTAGG + Intergenic
959432586 3:106273078-106273100 AAGGTGAGATGGAAGGAAGGAGG + Intergenic
959629270 3:108490163-108490185 AGGTTGAGGTGGAGAGAAGGTGG + Intronic
959730207 3:109592415-109592437 AAGATGAGAGGGTGAGAAGTGGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
959985446 3:112566209-112566231 TAGCTGAGATGGAGACTATTAGG + Intronic
960141919 3:114159343-114159365 AGGGAGAGATGGAGAGAAGGTGG - Intronic
960317951 3:116201138-116201160 AAGGTGGGATGGGGAGAAGGAGG - Intronic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
961082760 3:124040564-124040586 ATGCTGAGATGGAGAAACGCTGG + Intergenic
961091564 3:124117202-124117224 CAGCTCAGAGGGAGAGAAGGGGG + Intronic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
962223356 3:133583429-133583451 AACCTGAAATGCAGAGAAGAAGG - Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963031340 3:140981104-140981126 AAGGAAAGATGGATAGAAGTTGG + Intergenic
963275568 3:143326447-143326469 ATGGTGAGAGGGAGAGAAGAGGG - Intronic
963377059 3:144480876-144480898 AAGCTGAGATAGAGAAGACTTGG - Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964159750 3:153632774-153632796 AAGGTGAGAGGGAGAGAAGTAGG - Intergenic
964585370 3:158292875-158292897 AATCTGAGATTGAGAAAAGTTGG + Intronic
965447367 3:168791692-168791714 ATGGGGAGATGAAGAGAAGTTGG + Intergenic
965473503 3:169125017-169125039 AAGCTGAGAAAGAGAAAATTAGG - Intronic
965803933 3:172523176-172523198 AAGCTGACATGCAAAGAAGCAGG + Intronic
965883525 3:173415303-173415325 AATCTGAGATGGCAGGAAGTAGG + Intronic
966165626 3:177013458-177013480 AGGCAGAGACGGAAAGAAGTGGG + Intergenic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966827602 3:183978201-183978223 AAGCTGAGAAGCAGAAGAGTGGG - Intronic
967383832 3:188890119-188890141 AGGCGGAGATGGTGAGAAGCCGG + Exonic
967417535 3:189235393-189235415 AAGGGAAGATGGAGAGAGGTGGG + Intronic
968149373 3:196324949-196324971 AAGAAGGGAAGGAGAGAAGTGGG + Intronic
968331386 3:197873494-197873516 AAGCTGAGAAGGAGACAAGCAGG + Intronic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
970689830 4:18610319-18610341 ATGCAGAGAAGGAGGGAAGTGGG - Intergenic
971219212 4:24689574-24689596 AAGCAGAGAGGAAGAGAAGGTGG + Intergenic
971251877 4:24979424-24979446 GAGAAGACATGGAGAGAAGTGGG + Intronic
971675229 4:29617969-29617991 CAGCTGACATGGAATGAAGTAGG - Intergenic
972204957 4:36760471-36760493 AAAAAGAGATGGAGAGAATTGGG - Intergenic
972326729 4:38023488-38023510 AGGCTGAGAAGGAGCGGAGTTGG - Intronic
973046354 4:45538083-45538105 AAGCAGAGATAGAGACAAGCAGG + Intergenic
973839937 4:54851054-54851076 AAGCTGAGGCCCAGAGAAGTTGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
975138382 4:70896468-70896490 AAGCTGCCATGGGGAGAAGGAGG - Intergenic
975466451 4:74714523-74714545 TAGCTGAGCTGCAGACAAGTTGG - Intergenic
976011513 4:80494686-80494708 AAGCTGAGATGGGGAGGATGAGG - Intronic
976173545 4:82329310-82329332 AAGCTGGGTAGGAGAGAGGTTGG - Intergenic
976476958 4:85495290-85495312 AAGCTGAAAAGGGGAGAAGTAGG + Intronic
977808100 4:101326551-101326573 AAGCTGAAATGGCAAGAAGATGG - Intronic
978123500 4:105109646-105109668 AAGCTGAGAAAGAGACAAATAGG + Intergenic
978602490 4:110443474-110443496 AGGCTGAAAGGGAGAGAAGAGGG - Intronic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979108914 4:116725115-116725137 AAGTGGAGATGGCGAAAAGTAGG - Intergenic
979396533 4:120196302-120196324 AAGCTGAGGAAGAGAGAAGTTGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981345444 4:143671292-143671314 AAGCGGAGAGGGAGATAATTTGG - Intronic
981891272 4:149740900-149740922 AAGCTGAAGAGGAGAGAAGCTGG + Intergenic
982074359 4:151723814-151723836 AAGCTGTGATGGGTAGAGGTAGG + Intronic
982214386 4:153067604-153067626 AAACTGAGAAGGAAAGAATTGGG - Intergenic
982745247 4:159099676-159099698 AAGCTGAGATGGAAAGAAAAGGG + Intergenic
982998994 4:162388112-162388134 AAGCTGAGAGGGAAGGAAGAAGG - Intergenic
983523386 4:168734748-168734770 AAACTGAAAAGGAGAGAAGGAGG + Intronic
983974196 4:173912692-173912714 AAGCTGTGTTGAGGAGAAGTGGG + Intergenic
984095316 4:175427040-175427062 AATCTGTGAGGGAGAGATGTGGG - Intergenic
984350728 4:178588684-178588706 AAGCTGAGAGGGAAAAAAGGGGG + Intergenic
984500201 4:180549154-180549176 AAGGGGAGATAGAAAGAAGTTGG - Intergenic
984537590 4:180996222-180996244 AAGGAGAAATGGAGAGATGTTGG - Intergenic
984592924 4:181636641-181636663 CAGCAGAGGTGGGGAGAAGTGGG - Intergenic
984740622 4:183158004-183158026 AAGGTGAGATGGAGGAAAGGGGG - Intronic
985841197 5:2307313-2307335 AATCTGAGATGGAGACTGGTGGG + Intergenic
986639349 5:9857155-9857177 AGGAGGAGATGAAGAGAAGTTGG + Intergenic
986952596 5:13108575-13108597 ATGCTGTCATGGAGAGAATTTGG + Intergenic
987452588 5:18104786-18104808 ACACAGAGAAGGAGAGAAGTTGG + Intergenic
987473549 5:18362375-18362397 AAGCTGAAATGGGGAAGAGTGGG - Intergenic
987652829 5:20766265-20766287 AAGAGGAGATGAAGAGAAGTTGG + Intergenic
987739689 5:21890906-21890928 AAGCTGAAAGGGAGAAAAATTGG + Intronic
988156097 5:27450820-27450842 AGGAGGAAATGGAGAGAAGTAGG + Intergenic
988367032 5:30313640-30313662 AGGCGGAAATGGGGAGAAGTTGG - Intergenic
988742729 5:34095219-34095241 AAGAGGAGATGAAGAGAAGTTGG - Intronic
989210156 5:38851286-38851308 GAGCTGAGATGGAGGGAGGGAGG - Intronic
989238890 5:39180713-39180735 TAGCTAAGATGGAGAGCAGTAGG + Intronic
989305174 5:39946871-39946893 AAGCTGAGTTTGAGAGGATTGGG - Intergenic
989969469 5:50505095-50505117 AAGCTGAAGAAGAGAGAAGTTGG + Intergenic
990058563 5:51617756-51617778 TAGAGGAGATGGAGAGAGGTTGG - Intergenic
990346717 5:54878987-54879009 AATCTGGGATCCAGAGAAGTAGG + Intergenic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991981181 5:72232478-72232500 AAACATAGAGGGAGAGAAGTTGG + Exonic
991984399 5:72269003-72269025 CAGCTCAGATGGGGAGAAGGAGG + Intronic
992046366 5:72894343-72894365 ATGCTGAGATGCAGAAAAGGGGG - Intronic
994128510 5:96197318-96197340 CAGCTGAGTAGGGGAGAAGTTGG - Intergenic
994588881 5:101748592-101748614 AAGCTGAGGAAGAGAGAAGCTGG - Intergenic
994765291 5:103908667-103908689 AAGCTCAGAGTGAGAGAAGTGGG + Intergenic
995409119 5:111834717-111834739 AATCTGAGATGCAAAGCAGTGGG - Intronic
995683863 5:114749819-114749841 CAGCTGAGATGGCCAGAAGTGGG + Intergenic
996144830 5:119961419-119961441 AGGCTGGGATAAAGAGAAGTTGG + Intergenic
996211598 5:120817901-120817923 CAGCTGAGGTGTAGAGGAGTAGG - Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996368787 5:122731257-122731279 AAGGGGAGATGAAGAGAGGTTGG - Intergenic
997885152 5:137623301-137623323 AAGATGAGATTGAGAGAACATGG + Intronic
997983929 5:138488845-138488867 AAACTGAGGTTCAGAGAAGTAGG - Intergenic
998046979 5:138995693-138995715 AAGAGGAGATGAAGAGAGGTTGG - Intronic
998158937 5:139802214-139802236 AGGCAGAGAAGGAGAGGAGTTGG + Intronic
998682185 5:144481010-144481032 AAGCTGAGATTTACAGAAATAGG + Exonic
998721666 5:144958723-144958745 AAACTGAGTTGGAAAGATGTTGG + Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999674250 5:153983078-153983100 AAACTGAGGTGCAGAGAGGTTGG + Intergenic
999704783 5:154262301-154262323 GAGCTGAGAGGGACAGAAGGAGG - Intronic
1000200917 5:159010208-159010230 CAGATGAGATGGAGATGAGTAGG + Intronic
1000992587 5:167926380-167926402 AAGCAGAGTGGGAGAGAAATGGG + Intronic
1001061733 5:168496457-168496479 AAGCAGAGAGGGAGAGAAGTGGG + Intronic
1001276578 5:170355637-170355659 AAGCTGAGATGAGGAGAGGCAGG + Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1002849542 6:981700-981722 TGGCTGAGAAGGAGAGGAGTGGG - Intergenic
1003181502 6:3795766-3795788 AAGCTGAGAAAGTGAGAAGTTGG - Intergenic
1003742223 6:8953807-8953829 AAGTTCAGATGGAGTGGAGTGGG - Intergenic
1004315358 6:14582139-14582161 AAGCTGAGCTGGAGAAGAGGTGG - Intergenic
1007917285 6:45573209-45573231 AAGCTGAGTGAGAGGGAAGTTGG + Intronic
1008798476 6:55337138-55337160 GAGGAGAAATGGAGAGAAGTTGG - Intronic
1010246604 6:73665368-73665390 AAGGGGGGATGAAGAGAAGTTGG + Intergenic
1010652858 6:78475678-78475700 ATGCAGAGATGGAGAAAAATAGG + Intergenic
1010704149 6:79087840-79087862 AAATTGAGTTGGAGAGAAATAGG + Intergenic
1011492711 6:87908870-87908892 AAGCTGATAAAGACAGAAGTAGG - Intergenic
1012275791 6:97274022-97274044 AAGCTGACATGGAGTGAGGTTGG - Intronic
1012390258 6:98730055-98730077 GAGCTGAGAGGGAGAGACTTAGG + Intergenic
1012467585 6:99532749-99532771 AATCTGGGATCCAGAGAAGTAGG + Intergenic
1012616277 6:101283304-101283326 AAGCTCCCATGGGGAGAAGTGGG + Intergenic
1012761332 6:103306333-103306355 ATGCTGAGATGGAATAAAGTGGG + Intergenic
1013580021 6:111524493-111524515 AAGCAGAGATGGGGAGGAGGTGG - Intergenic
1015051669 6:128848301-128848323 AAGCTGAGATGCAGTCAAGGGGG - Intergenic
1015873466 6:137799948-137799970 CAGCTGAGATGTAGAGAAAAGGG - Intergenic
1016124062 6:140377325-140377347 AAGCCAAGATGTAGAAAAGTAGG - Intergenic
1016746787 6:147589366-147589388 AATCAGAGGTGGAGAGAAGTGGG - Intronic
1016984773 6:149887027-149887049 CAGCTGAGCTGAACAGAAGTGGG - Intronic
1020683655 7:11267604-11267626 AAGCTGGGATGCAAAGAAGCAGG - Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021801063 7:24306752-24306774 CAGATGAGATAGAGAGAAGCTGG + Intergenic
1021840413 7:24717677-24717699 AACCTGTGATGGAGGGAATTGGG - Intronic
1022338224 7:29443311-29443333 AAGCTGAGAAGTACTGAAGTTGG + Intronic
1022419246 7:30205163-30205185 AAGATGAGACGTGGAGAAGTGGG - Intergenic
1022622198 7:31996135-31996157 AAGTTGAGAGAGAGAGAAGCTGG + Intronic
1022633315 7:32106445-32106467 AGACAGAGATAGAGAGAAGTGGG + Intronic
1023019337 7:35996546-35996568 AAATTGAGATGTAGAAAAGTTGG - Intergenic
1023456281 7:40342149-40342171 TGGCTGAGTTGGAGAGAAGATGG - Intronic
1024741595 7:52360854-52360876 CAGATGAGAAGGAGAGAAGGTGG - Intergenic
1027691903 7:81358151-81358173 AAGGAGAGAGGGAGAGAAATAGG - Intergenic
1028057150 7:86260070-86260092 AAGGTGGGTTGGAGAGATGTTGG + Intergenic
1028139043 7:87252144-87252166 AAGCAGACATGGAAAGGAGTGGG + Intergenic
1030095326 7:105893837-105893859 AAGCACAGATTCAGAGAAGTGGG + Intronic
1030292919 7:107890033-107890055 AAGATGAGATGAAGCGAAATTGG - Intergenic
1030537909 7:110791895-110791917 ATGATGAGGTGGAGAGAAGCAGG + Intronic
1031064385 7:117089190-117089212 AAGCAGACATGGAGACAAATTGG - Intronic
1031680595 7:124668887-124668909 AAGCTGAAAGAGACAGAAGTTGG + Intergenic
1031923452 7:127617870-127617892 AGGCAGAGTGGGAGAGAAGTTGG + Intergenic
1031993016 7:128210146-128210168 AAGGAGAGAAGGAGAGAAGGAGG + Intergenic
1032432389 7:131872483-131872505 AATATGAGTTGGAGAGATGTGGG + Intergenic
1032653457 7:133903411-133903433 CAGCAGAGATGGAGGGAACTGGG + Intronic
1032661378 7:133987482-133987504 AAGCGGGGAGGGAGAGAAGAAGG + Intronic
1032853623 7:135816169-135816191 TGGTTGAGATGCAGAGAAGTGGG + Intergenic
1033083836 7:138323629-138323651 AAGCAGAAAAGGAGAGATGTTGG + Intergenic
1033261840 7:139850727-139850749 ATGCTGAGATGGACAGAGGGAGG + Intronic
1034523490 7:151639230-151639252 TAGCAGGGATGGAGACAAGTGGG - Intronic
1034754839 7:153606594-153606616 AAGCTGTGATTGAGAAGAGTAGG - Intergenic
1036336041 8:7870498-7870520 AAGCAGTGAAGGAGAGAAGGAGG - Intergenic
1036475208 8:9087001-9087023 AAGATGAGAAGGTGAGAAGGAGG - Intronic
1037089752 8:14899298-14899320 AAGAAGAGAGGGAGGGAAGTGGG - Intronic
1037944722 8:22981662-22981684 AAGCTGAAAGGGACAGAGGTGGG + Intronic
1038486396 8:27938034-27938056 AAGATGAACTGGAAAGAAGTTGG + Intronic
1038886270 8:31666215-31666237 AGGCTGAAATTGAGAGAAGGAGG + Intronic
1040435582 8:47387704-47387726 GCTCTGAAATGGAGAGAAGTTGG + Intronic
1040927902 8:52704179-52704201 AAACTGAGATTCAGAGAAATTGG - Intronic
1040939519 8:52818174-52818196 AAGCTGAGATGGCCAGAACAAGG - Intergenic
1041185907 8:55300446-55300468 GAGCTGAGGTGGAGTGAAGGTGG + Intronic
1041449610 8:57993315-57993337 TACTTGAGAGGGAGAGAAGTTGG + Intergenic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041649007 8:60282626-60282648 ACACTGAGATGGAAAGAAGTGGG + Intergenic
1041796884 8:61754313-61754335 AAGGTGAGAGGGAGGGAAGGAGG - Intergenic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1042022754 8:64386675-64386697 AAGCAGAGAGAGAGAGAGGTAGG - Intergenic
1042508240 8:69584114-69584136 AATCTGAGATTGCGAGAAGAGGG + Intronic
1042805163 8:72763481-72763503 AAACTGAGATGGAGCTAAATGGG + Intronic
1043871613 8:85439166-85439188 AAACTGAAGTGCAGAGAAGTTGG + Intronic
1044261422 8:90127836-90127858 GAGGTGAGATGTAGGGAAGTTGG + Intergenic
1045370623 8:101518753-101518775 TAGCAGAGATGGAAAGAACTTGG - Intronic
1045372611 8:101539751-101539773 ATGCTGAGATGGTGAGATGTGGG - Intronic
1045826533 8:106404334-106404356 AAGTTGGGATGGAGATATGTAGG - Intronic
1046452015 8:114405792-114405814 AGGCGGAGATAGGGAGAAGTTGG + Intergenic
1047671617 8:127153969-127153991 AGTCTGAGATAGAGAGAAATTGG - Intergenic
1047789048 8:128183737-128183759 AAGATGTGATGGAGAGAGGCTGG - Intergenic
1047878047 8:129162103-129162125 ATGATGAGATGGAGAGATGATGG + Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1048748983 8:137649606-137649628 AAGAGGAGATGGAAAGAAGGAGG + Intergenic
1049277733 8:141728352-141728374 CAGCTGGGAGGCAGAGAAGTGGG - Intergenic
1049299037 8:141860088-141860110 ATGCGGAGATGGAGAGAGGTGGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049539827 8:143203304-143203326 AAGCGGAGCTGGAGAAATGTGGG + Intergenic
1049609922 8:143550146-143550168 AGGTTGGGCTGGAGAGAAGTGGG - Intergenic
1049906935 9:226536-226558 GAGCTGAGAAGGAGAGAACCAGG + Intronic
1050027260 9:1348666-1348688 AAGCTGAGAGGGTGGGATGTGGG + Intergenic
1050085068 9:1956562-1956584 AAGAGGAGATGGAGAGAGGTTGG + Intergenic
1050306823 9:4313363-4313385 AAGGTGAGATGGAGAGGGGGAGG - Intronic
1050782606 9:9356604-9356626 AAGTAGTGATGGGGAGAAGTAGG + Intronic
1050820226 9:9869866-9869888 CAGCAGAGATTGAGACAAGTGGG + Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051006742 9:12354410-12354432 AACCTGAGATGGAGGGCAGCTGG + Intergenic
1051906468 9:22100783-22100805 AAGCAAAGATGTGGAGAAGTGGG - Intergenic
1051939322 9:22485942-22485964 AAGGTGAGACTGAGACAAGTGGG + Intergenic
1051954729 9:22678126-22678148 ATGCTTAAATAGAGAGAAGTAGG - Intergenic
1052074519 9:24124472-24124494 CAGCTGAGAAGCAGAGAAGGAGG - Intergenic
1052426551 9:28312341-28312363 AAAATGAGAGGGAGAGAAGAGGG + Intronic
1052658547 9:31398245-31398267 AGGGGGAGATGAAGAGAAGTTGG - Intergenic
1053172802 9:35902804-35902826 AGGCTGAGATGGGGATAAGCGGG - Intergenic
1053510116 9:38680569-38680591 GAGTTGAGATGTAGAAAAGTGGG + Intergenic
1053564652 9:39236374-39236396 AGACTGAGATGGAGAGAATATGG - Intronic
1053830438 9:42074275-42074297 AGACTGAGATGGAGAGAATATGG - Intronic
1054132500 9:61382660-61382682 AGACTGAGATGGAGAGAATATGG + Intergenic
1054600121 9:67113180-67113202 AGACTGAGATGGAGAGAATATGG + Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055796900 9:79984500-79984522 ATGCTAATATGGATAGAAGTTGG + Intergenic
1056404315 9:86259449-86259471 AAGGAGAGATGGAGTGAGGTGGG - Intronic
1056470820 9:86903264-86903286 AAGCGCGGATGGAGAGGAGTAGG - Intergenic
1056673396 9:88651347-88651369 GAGCAGAGATGGAAAGAAGTGGG + Intergenic
1056781537 9:89554678-89554700 AGGATGTGATGGAAAGAAGTGGG - Intergenic
1057386960 9:94613142-94613164 AAGCAGAGATTCAGAAAAGTAGG - Intronic
1057953848 9:99391577-99391599 GGGCTGAGAAGGAGAGAAGCAGG - Intergenic
1058596962 9:106625282-106625304 AAGTTGAGATGGAGAGCCATGGG + Intergenic
1058732292 9:107861922-107861944 AAGAGCAGATGGAGAGAAGTGGG + Intergenic
1059592468 9:115677032-115677054 AAGATGAAATGGAGATATGTGGG + Intergenic
1059853496 9:118369087-118369109 AAGCTGAGGTGGATAGATCTTGG + Intergenic
1060051211 9:120379729-120379751 CAGCTGAGATGGAGAGACACAGG + Intergenic
1060801146 9:126546520-126546542 AAACTGAGGTGCAGAGAAGTTGG - Intergenic
1060835261 9:126751040-126751062 AAGCAGGTATGCAGAGAAGTGGG - Intergenic
1060927206 9:127463355-127463377 AAGCTGGGAGGGAGAGAAGGAGG + Intronic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061383787 9:130276367-130276389 AAGCTGAGGTGGAGAGAAGCTGG + Intergenic
1061442125 9:130612732-130612754 GAGCTGAGGTGGGGAGAGGTGGG - Intronic
1185534838 X:852853-852875 AAGAAGGGATGGAGAGAGGTTGG - Intergenic
1186203265 X:7175517-7175539 AAGCTGATATGTACAGAGGTGGG - Intergenic
1186376413 X:9006799-9006821 GAGGTGGGATGGAGGGAAGTGGG - Intergenic
1186451498 X:9677615-9677637 AAGCTGAGAAAGAGAGAGGGAGG - Intronic
1186532429 X:10310878-10310900 AAGCTGAGAGGGAGAGAGAAAGG + Intergenic
1186650442 X:11554302-11554324 GAGGTGAGATGAAGAGAGGTTGG + Intronic
1186658721 X:11645736-11645758 AAGAGGAGAAGGAGAGGAGTAGG + Intronic
1186674528 X:11802481-11802503 GAGCTGAGATGGGGTTAAGTAGG - Intergenic
1186949641 X:14609339-14609361 AAGCTGAGTTTGAGAGAATCAGG + Intronic
1187353452 X:18543427-18543449 AAGCCAAGATGGAAAGAAGATGG - Intronic
1187944641 X:24414427-24414449 AAGGTGAGAGGGAGAGAAAAGGG - Intergenic
1188706327 X:33336612-33336634 AATCTGAGTTTGAGAGAATTGGG + Intronic
1188786787 X:34356496-34356518 AAGTTGAGTTGGAGGGAAGAAGG - Intergenic
1189222646 X:39385424-39385446 AGGCAGAGATGGTGTGAAGTGGG - Intergenic
1190302526 X:49065010-49065032 CAGGTGAGAGGGGGAGAAGTGGG - Intronic
1190545759 X:51524770-51524792 AAACTGAGACTCAGAGAAGTAGG + Intergenic
1191053189 X:56216143-56216165 AAGTGAAGATGAAGAGAAGTAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191085453 X:56563361-56563383 AGGGTGAGACGGAGAGAAGGAGG - Intergenic
1191843039 X:65526612-65526634 AACCTCAGCTAGAGAGAAGTTGG - Intronic
1192484455 X:71513111-71513133 AAGCTGAGAAGGAAAGGAATTGG + Intronic
1192656191 X:72997587-72997609 AAGCTAAGATGGAAAAAAGGGGG + Intergenic
1192665929 X:73085414-73085436 AAGCTAAGATGGAAAAAAGGGGG - Intergenic
1193193800 X:78605834-78605856 AGGGAGAGATGAAGAGAAGTTGG + Intergenic
1193450362 X:81658060-81658082 CAGCTGAGATGGTGACAATTGGG + Intergenic
1194591094 X:95800562-95800584 AAGCTGAGGAAGAGAGAAGCTGG - Intergenic
1194677244 X:96809166-96809188 AAGTTGCAATGGAGAGAAGACGG - Intronic
1194863747 X:99039304-99039326 ATGCTGAGATGGTGAGAATGGGG + Intergenic
1195077149 X:101338096-101338118 AAGCAGAAATGGAGAGAAGGAGG - Intergenic
1195100114 X:101547375-101547397 CAGCTGAGATGAAGAAAAGCAGG - Intergenic
1195327753 X:103771726-103771748 GGGCTGAGATGCAGAGAAGAAGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195413455 X:104594687-104594709 AAGCTGTGATAGAGAGTAATGGG + Intronic
1196912643 X:120499650-120499672 AGGCAAAGATGGAGGGAAGTGGG - Intergenic
1197209377 X:123816519-123816541 AAGAAGAGAAGGAGAGAAGGTGG + Intergenic
1197490894 X:127116514-127116536 AAGATGAGTTGCAGAAAAGTGGG + Intergenic
1198547855 X:137712300-137712322 AGGCTGGGAAGGATAGAAGTGGG - Intergenic