ID: 1070543655

View in Genome Browser
Species Human (GRCh38)
Location 10:77435866-77435888
Sequence CTCTGTCACTGCCAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070543655_1070543659 -3 Left 1070543655 10:77435866-77435888 CCATCCACCTGGCAGTGACAGAG 0: 1
1: 0
2: 0
3: 26
4: 253
Right 1070543659 10:77435886-77435908 GAGCTCAGAGGTCTTCATTTTGG No data
1070543655_1070543660 8 Left 1070543655 10:77435866-77435888 CCATCCACCTGGCAGTGACAGAG 0: 1
1: 0
2: 0
3: 26
4: 253
Right 1070543660 10:77435897-77435919 TCTTCATTTTGGATGAACCATGG No data
1070543655_1070543661 9 Left 1070543655 10:77435866-77435888 CCATCCACCTGGCAGTGACAGAG 0: 1
1: 0
2: 0
3: 26
4: 253
Right 1070543661 10:77435898-77435920 CTTCATTTTGGATGAACCATGGG No data
1070543655_1070543664 30 Left 1070543655 10:77435866-77435888 CCATCCACCTGGCAGTGACAGAG 0: 1
1: 0
2: 0
3: 26
4: 253
Right 1070543664 10:77435919-77435941 GGACCCAGATGCCTATGAAAGGG No data
1070543655_1070543663 29 Left 1070543655 10:77435866-77435888 CCATCCACCTGGCAGTGACAGAG 0: 1
1: 0
2: 0
3: 26
4: 253
Right 1070543663 10:77435918-77435940 GGGACCCAGATGCCTATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070543655 Original CRISPR CTCTGTCACTGCCAGGTGGA TGG (reversed) Intronic
900212341 1:1462313-1462335 CTCTGCCACTGCCAGTTTAACGG + Intronic
900615017 1:3561545-3561567 CTCTGTCCCTGCGGGGTGCATGG - Intronic
900683031 1:3928242-3928264 TTCTGTCACTGGCAGGTGTTGGG - Intergenic
901232728 1:7650167-7650189 CTCTGACGCTGCCAGGCGGCCGG + Intronic
902128438 1:14237538-14237560 CTCTCTCATTGCCAGGGAGAGGG - Intergenic
903025812 1:20429324-20429346 CTGTGGCACTGCAAAGTGGAAGG - Intergenic
904030243 1:27528962-27528984 CCCTGTCCTTGCCAGGTGGGGGG - Intergenic
904420395 1:30387305-30387327 TCCTGTCACTGCCATGTGGTGGG - Intergenic
905149386 1:35915333-35915355 CTCTCTGACTGTCAGGTGGTAGG + Exonic
906697464 1:47832919-47832941 GACTGTGACAGCCAGGTGGAGGG - Intronic
907832175 1:58075385-58075407 CTGTGTCACTTCCAAGTGGAAGG + Intronic
910360034 1:86406800-86406822 CTCTGTGACTGTCAGGTAAAAGG - Intergenic
911121488 1:94301523-94301545 ATCTGTCACTGCAATGGGGAGGG + Intergenic
911536292 1:99105076-99105098 GTCTGTCACTGCCAGGAGAAGGG - Intergenic
911682284 1:100731250-100731272 CTCTGTCACTGTAAGCTGCAAGG + Exonic
912118562 1:106439157-106439179 TTCTGTCACTCACAGATGGAAGG + Intergenic
913446734 1:118958251-118958273 CTCTCTCTCTACCATGTGGATGG + Intronic
915936592 1:160093309-160093331 CACTGTCACTGCCAGCTGGCTGG + Exonic
917783012 1:178419618-178419640 TTCTGTCATTGGCAGGTGAAAGG - Intronic
919926439 1:202194101-202194123 CCCTGCCACTGCCAGGAGGACGG + Exonic
920045518 1:203129789-203129811 CTCTGTTACAGACAGGAGGAAGG + Intronic
920253955 1:204641743-204641765 CTCTCTCACAGCCAGGTAGTTGG - Intronic
920420117 1:205827547-205827569 CTCAGTAGCTGCCAGGTGGGGGG - Intergenic
921742020 1:218696055-218696077 CTCTATCACTGCCAATTGAATGG + Intergenic
922066844 1:222152405-222152427 CTATGTCACTCCATGGTGGAAGG - Intergenic
922465819 1:225845131-225845153 CTCTTTCACTTCCAGGATGAAGG + Exonic
924386782 1:243506496-243506518 CTCTGTCACTCCGAAGAGGAGGG + Intronic
1063615830 10:7599834-7599856 CACTCTCCCTGCCTGGTGGAGGG - Intronic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1068439031 10:57028415-57028437 CTGTGTCACCTCCTGGTGGAGGG - Intergenic
1068781297 10:60921698-60921720 CTCTGCCAGCCCCAGGTGGAAGG - Intronic
1068901665 10:62276667-62276689 CTCTGCCAATGGCAAGTGGAAGG - Intergenic
1069172604 10:65252783-65252805 CTGTGTCATTGCCAGGTGTGAGG - Intergenic
1069517924 10:69094211-69094233 CTCTGCCACTGCCTGGAGGCTGG - Intronic
1069550881 10:69363175-69363197 CTGTGTCACTGCCATGTGTAAGG + Intronic
1070543655 10:77435866-77435888 CTCTGTCACTGCCAGGTGGATGG - Intronic
1070717382 10:78732567-78732589 CTCTGCCACCACCGGGTGGATGG + Intergenic
1074778230 10:116781972-116781994 CTTTGTCACTCACAGGTGTAAGG - Intergenic
1074857745 10:117485908-117485930 CTCTGCCACTTGCAGGTGGCAGG - Intergenic
1075679961 10:124324721-124324743 CTATGTGCCTGCCTGGTGGAGGG - Intergenic
1075863353 10:125696510-125696532 GTCTGTCTGTGCCAGGTGGAGGG - Intergenic
1076033893 10:127182783-127182805 CTCTGTCACTGTCATGATGATGG - Intronic
1076210865 10:128643843-128643865 CTCTGTGACTAACAGGTGGGTGG + Intergenic
1077336661 11:2008159-2008181 CTCTGTTCATGCCAGGAGGATGG + Intergenic
1078064831 11:8071645-8071667 GTCTGTCAGAGCCAGGAGGATGG + Intronic
1078662239 11:13296916-13296938 CACTGTCACAGGCAGGAGGACGG - Intronic
1079345356 11:19646976-19646998 CTCTGCCACAGGCAGGTGGCAGG + Intronic
1079461736 11:20686510-20686532 GACTGTCACTGCCGGGTGGTTGG + Intronic
1079980263 11:27143723-27143745 TTCAGTCCCTGCCTGGTGGAAGG - Intergenic
1082786017 11:57317183-57317205 CTCAGTCACTGCTTGCTGGATGG + Intronic
1083207782 11:61163126-61163148 CTCTGAGGCTGCCAGGTGGTTGG - Intergenic
1083270853 11:61571847-61571869 CTCTGTCATTGCCAGGTATGGGG + Intronic
1084914509 11:72418285-72418307 CCCTGTCACAGCAAGGTGTATGG - Intronic
1085503664 11:77043280-77043302 CTGTGTCACTGCATGGTGGGAGG + Intergenic
1087756651 11:102061750-102061772 CTCTGTCACTTCCACGTTGATGG + Intronic
1088069454 11:105763730-105763752 GTCTGTCATTGCCATTTGGAAGG + Intronic
1089901789 11:121994018-121994040 CTCAATCACTGCCAAGAGGATGG - Intergenic
1202819645 11_KI270721v1_random:63341-63363 CTCTGTTCATGCCAGGAGGATGG + Intergenic
1091750556 12:3019156-3019178 CGCTGCCTCTGCCAGGTGGGTGG + Exonic
1091939904 12:4469890-4469912 CTCTCTGACTGCCATGTAGATGG - Intergenic
1094004894 12:25738842-25738864 CTCTCTCTCTGCCTGATGGAAGG + Intergenic
1094352894 12:29546274-29546296 CCCTGTCACTTGCAGGAGGAGGG + Intronic
1096860763 12:54526285-54526307 CTCTGCCACTGCCAGCTGTGTGG + Intronic
1101054171 12:100895095-100895117 CTCTTTAACTGCAAAGTGGAGGG - Intronic
1101159287 12:101956909-101956931 CTCTGTGAGTGCCATGTGGCAGG + Intronic
1102039677 12:109792760-109792782 CTCGATCCCTGCCAGGTAGAGGG + Exonic
1102193076 12:111003954-111003976 CTCTGTAAATGCCAGTTGGAGGG - Intergenic
1103410704 12:120710026-120710048 CTTTGGTCCTGCCAGGTGGAGGG - Intergenic
1103719819 12:122967131-122967153 CTCAGTGACTGCCAGGTGCTGGG + Intronic
1104002920 12:124871879-124871901 CTGTGTCCTTGCCTGGTGGAAGG - Intronic
1104110784 12:125702262-125702284 CTGTGTCCCCACCAGGTGGAGGG + Intergenic
1107481797 13:40791206-40791228 CTCTGTCACTGACAGTTGTGTGG + Intronic
1108098861 13:46934232-46934254 CTCTGTCTCTCCCAGGCAGATGG - Intergenic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1109598862 13:64596301-64596323 TTCTGTCACTGTTGGGTGGATGG - Intergenic
1110439665 13:75513548-75513570 CCCTGGCACTGCCATGTGGTTGG - Intergenic
1111750379 13:92322931-92322953 CTCTTTCCCTGACAGGTAGAGGG - Intronic
1112234484 13:97623434-97623456 CTCTGTCACTTCCAGGAGAAGGG + Intergenic
1114147400 14:19993651-19993673 GTCTGTAACTTCCAGGTGCATGG + Intergenic
1114484229 14:23053567-23053589 CTCAGGCACTGTCAGGTGGTAGG + Exonic
1115085772 14:29513171-29513193 CTCTGCCAGGGCAAGGTGGAAGG - Intergenic
1116231842 14:42228570-42228592 CTCTGTCATTGCCACTAGGAAGG - Intergenic
1117266474 14:54093211-54093233 CTGTTTCACTGCTAGGAGGAGGG - Intergenic
1117551068 14:56836809-56836831 TTCCATCACAGCCAGGTGGAAGG + Intergenic
1117602335 14:57389241-57389263 CTTTGTCACAGCCTGGTGGCTGG - Intergenic
1118597574 14:67447922-67447944 CTCTTTCACTTCCAGATGCAAGG - Intronic
1119872921 14:78032385-78032407 TTCTGTCACTGGCAAGTGAAAGG - Intergenic
1121111159 14:91314013-91314035 CTCCGTCACCGTCTGGTGGAGGG + Exonic
1121547249 14:94771249-94771271 CTCTGGGCCTGCCAGGCGGAAGG - Intergenic
1121582193 14:95039484-95039506 CTCCGTCACTCCCACCTGGAGGG - Intergenic
1122861431 14:104584328-104584350 CTCTCCCACTGCCCGGCGGAAGG - Intronic
1122896397 14:104759701-104759723 CTTTGGCCCTCCCAGGTGGAGGG - Intronic
1127219984 15:56869746-56869768 CACTCTGACTACCAGGTGGATGG + Intronic
1127390808 15:58503729-58503751 CCCTGTCTCTGGCAGGTGCAGGG - Intronic
1127827266 15:62715669-62715691 CTCTTTTTCTGTCAGGTGGACGG + Intronic
1129461072 15:75700353-75700375 TTCTGTCAGGGCCGGGTGGAGGG + Intronic
1129723749 15:77891372-77891394 TTCTGTCAGGGCCGGGTGGAGGG - Intergenic
1130047825 15:80459963-80459985 CACAGTCACTGCAAAGTGGAGGG - Intronic
1130114486 15:80994809-80994831 CTCTGGCAGGGCGAGGTGGATGG - Intergenic
1131037447 15:89232614-89232636 CTGTGTCCTTGCAAGGTGGAAGG - Intergenic
1131392666 15:92061962-92061984 GTCTGTCAATGCCATCTGGATGG - Intronic
1132818924 16:1851459-1851481 CTCTGTCTCTCCCTGCTGGAGGG + Intronic
1134136387 16:11679239-11679261 CGCTGACATTGGCAGGTGGAGGG + Exonic
1135190153 16:20348165-20348187 ACCTGTCACTGCCTGGGGGAGGG - Intronic
1135698327 16:24610074-24610096 CTCTGTCACTGACTGGGGGTAGG + Intergenic
1136063560 16:27743490-27743512 CTCAGTCAGTGTCAGGAGGAGGG + Intronic
1137506792 16:49061082-49061104 CTCTTTCAGTGCCAGGCTGAGGG + Intergenic
1137546456 16:49407934-49407956 CTCTGCCTCTGGGAGGTGGAAGG - Intergenic
1137548207 16:49418524-49418546 GTCTGTCTCTGGCATGTGGAAGG - Intergenic
1138467279 16:57201161-57201183 CGGTGTGGCTGCCAGGTGGAGGG + Intronic
1138467298 16:57201241-57201263 CGGTGTGGCTGCCAGGTGGAGGG + Intronic
1139223022 16:65204068-65204090 CCCTTTCTCTGCCAGATGGATGG + Intergenic
1140225825 16:73076003-73076025 CTCTGCCACTAACAGCTGGATGG + Intergenic
1141662502 16:85449030-85449052 CTCTGTCAAAGGCAGGTGGCCGG + Intergenic
1143298097 17:5886372-5886394 TTCTGTCACTCCCAGATGGCTGG + Intronic
1144832117 17:18137569-18137591 CTCAGGTCCTGCCAGGTGGATGG - Exonic
1147001929 17:37369737-37369759 CTCTGTAACTGCAGGCTGGAGGG + Intronic
1147787685 17:42991430-42991452 CTCTGTCAGCACCATGTGGATGG - Exonic
1150252681 17:63716631-63716653 CTCTGATTCTGCCAGTTGGATGG + Intronic
1151224536 17:72638843-72638865 CTCGCTCCCTGCCAGGAGGAGGG + Intergenic
1152095616 17:78270018-78270040 TGCTGCCTCTGCCAGGTGGAGGG + Intergenic
1152778995 17:82218213-82218235 CTCAGTCACTGGGGGGTGGACGG + Intergenic
1152779024 17:82218292-82218314 CTCGGTCACTGCGGGGTGGACGG + Intergenic
1152779069 17:82218411-82218433 CTCGGTCACTGCGGGGTGGACGG + Intergenic
1152779082 17:82218450-82218472 CTCGGTCACTGCGGGGTGGACGG + Intergenic
1152781117 17:82227843-82227865 CTCTGTGAATGCCAGCGGGAGGG + Intergenic
1152868105 17:82736096-82736118 CTTTCCCACTGCCAGGAGGACGG - Intronic
1156204123 18:34867611-34867633 CTCTCTCTCTGCTAGGAGGAGGG - Intronic
1156373833 18:36494745-36494767 CTCTGGGACTGCCAGGTGGGAGG - Intronic
1156816522 18:41317801-41317823 CTGTCTAAATGCCAGGTGGAAGG - Intergenic
1157862310 18:51152273-51152295 CTTTGTCACTCCCAGGGCGATGG + Intergenic
1158152383 18:54387450-54387472 CTCTGTCACTCCCAGGGGTCGGG - Intergenic
1159043441 18:63346197-63346219 CCCTGGCAATGCCCGGTGGATGG - Intronic
1161453560 19:4359563-4359585 CCCTTTCTATGCCAGGTGGAGGG - Intronic
1163644840 19:18483291-18483313 CACTGCAACTGCCAGGTGGGCGG - Intronic
1163670496 19:18625162-18625184 CTCAGTAACTTCCAGGTGGCTGG - Intergenic
1164413258 19:28022778-28022800 GTCTGACACTGCCAGGTTCAAGG + Intergenic
1164517747 19:28950233-28950255 GTCTGACACTGCCAGGTTCAAGG + Intergenic
1165090824 19:33387654-33387676 CCCTGTCTTTGCCAGGTGGATGG + Intronic
1165181259 19:33972959-33972981 CTCAGTCACTGCCACGCAGATGG - Intergenic
1166002251 19:39884816-39884838 CTTTACCACTGCCACGTGGAGGG + Intronic
1166005035 19:39901067-39901089 CTTTACCACTGCCACGTGGAGGG + Intronic
1166091832 19:40514347-40514369 CTCAGTGGCTGCCATGTGGAGGG + Intronic
1166505192 19:43366860-43366882 TTCTGTCACTAGCAGTTGGAAGG + Intergenic
1168724238 19:58572065-58572087 CTCTCTCTTTACCAGGTGGATGG + Intronic
925293659 2:2764194-2764216 CTCTGGCCCTGCAAGGCGGAGGG + Intergenic
925331522 2:3062472-3062494 CTCTGCATCTCCCAGGTGGATGG + Intergenic
926522847 2:13938199-13938221 CTGTATCACTGCCATGTTGAAGG + Intergenic
928262180 2:29777956-29777978 CACTGTTTTTGCCAGGTGGAAGG - Intronic
931785659 2:65617244-65617266 CTCTGACACTACCAGTAGGAGGG - Intergenic
932856544 2:75240568-75240590 CTCAGGCACTGGCAGGAGGAGGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934738567 2:96702887-96702909 GTCTATCACTGCTGGGTGGAGGG + Intergenic
934969120 2:98748884-98748906 CTCTGGCCCTGCCATGTAGATGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
940591075 2:155728486-155728508 CCCTGTCACTGTCAGCTGCATGG + Intergenic
943088898 2:183350711-183350733 CTCTGCCACAGCCTGGGGGAGGG - Intergenic
944023885 2:195140906-195140928 CTCTGGTAGTGCAAGGTGGATGG + Intergenic
944471026 2:200054532-200054554 CTGTGCCACTCCCAGGTGGGCGG - Intergenic
944635541 2:201672889-201672911 GTGTGTCTCTGCCAGGTTGATGG - Intronic
946426857 2:219603466-219603488 CTTTATCTCTGACAGGTGGATGG - Intronic
948005649 2:234605537-234605559 CTCTGACCCTGCAAGGTGTAAGG - Intergenic
948777456 2:240297057-240297079 TGCTGGCACTGCCAGGTGCAGGG - Intergenic
1169134492 20:3189045-3189067 CTCTGCCACTGCCATGCAGATGG - Intergenic
1169571681 20:6913187-6913209 CTCTGGCACTGAGAGGTGGGGGG + Intergenic
1171424883 20:25043064-25043086 CCCTGTCCCTGGCAGGGGGAGGG - Intronic
1172621241 20:36319886-36319908 CTCTGTCACAGCAAGGTAGCGGG + Intronic
1173810778 20:45953835-45953857 CCCTGGCTCTGCCACGTGGAGGG + Exonic
1175171603 20:57085047-57085069 CCCTGTGACTGTCAGGTGGCAGG - Intergenic
1175814564 20:61876821-61876843 CTTTCCCACTGCCGGGTGGAGGG + Intronic
1176612193 21:8993081-8993103 CAGTGTCACTGCCAGGTAGGAGG - Intergenic
1180842517 22:18965942-18965964 AGCTGTCACTGCCAGGTGGGTGG + Intergenic
1181058964 22:20272914-20272936 AGCTGTCACTGCCAGGTGGGTGG - Intronic
1183728930 22:39606127-39606149 CTCTGTCCCTGGCAGGAGAACGG + Intronic
1183913221 22:41094271-41094293 CACTCTCACTGGCAGATGGAGGG - Intronic
1184116131 22:42423406-42423428 CTCTGTTACTGGGAGGTGGTAGG - Intronic
1184276711 22:43412886-43412908 CTCTGGCCCTGCCAGGGTGAAGG - Intronic
1184281595 22:43440630-43440652 CTCTGTGACTGGCAGGTGCCAGG + Intronic
1184661883 22:45969211-45969233 CCCTGCCACAGCCAGGTGGTCGG + Intronic
1184864131 22:47193038-47193060 GCCTGTCCCTGCCAGGAGGAGGG - Intergenic
949911792 3:8916214-8916236 CTCTCTCACTGCCAGGGGCAGGG - Intronic
952881745 3:37990132-37990154 CTCTCTCACTGTGGGGTGGAGGG - Intronic
954645776 3:52130747-52130769 CTCTGTCCACCCCAGGTGGAGGG - Intronic
959950670 3:112176258-112176280 CTGTGTCACTCCCAGGTGGGTGG + Intronic
959957010 3:112251251-112251273 CTGTGTCACTCCTAGGTGGGTGG - Intronic
961085218 3:124061383-124061405 CTCTGTCACTGACATGTTGTGGG - Intergenic
963256198 3:143147250-143147272 TTCTGTCCCTTCCAGCTGGAGGG - Intergenic
965331396 3:167379224-167379246 CTCTCTCCCTGCCAGGTGTCAGG + Intronic
965893213 3:173540533-173540555 ATGTGTCACTTCCAGGTGGAGGG - Intronic
966883126 3:184361007-184361029 CTGTGTCCCTGCCATGTGCATGG - Intronic
968976009 4:3822347-3822369 CCCGGGCACTGCCAGGTGGGAGG - Intergenic
969102285 4:4778202-4778224 CTGAGTCACTGCCTGGAGGAAGG - Intergenic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
972737880 4:41863618-41863640 CTCTCTCTCTGCCCTGTGGAAGG + Intergenic
973395606 4:49590940-49590962 CTCACTCACTGTCAGGAGGATGG - Intergenic
974080399 4:57206460-57206482 CACTGTCACAGCCAGCTGAATGG - Intergenic
975454380 4:74573099-74573121 CTCTGTCACTTCCAAGCTGAGGG + Intergenic
975503783 4:75116519-75116541 CACTGTCACTGCCAGGGGATTGG - Intergenic
975906176 4:79214870-79214892 CTGTGTCATTCCCTGGTGGAAGG - Intergenic
981913656 4:150010596-150010618 CTCTCTGGCTGCCATGTGGAGGG - Intergenic
984219997 4:176963283-176963305 CTTTTTCATTGCCAGCTGGAAGG + Intergenic
985067441 4:186136837-186136859 CTCGGGCACAGACAGGTGGACGG - Intronic
985523638 5:390994-391016 CTCTGCCACTGCCTCCTGGAGGG - Intronic
986571294 5:9168634-9168656 CCCTGTCACTCACAGGTTGAAGG - Intronic
989253385 5:39341186-39341208 CTCTGTCTCTGCAGGGGGGACGG + Exonic
991098506 5:62765203-62765225 CTCTGTGACTACCTGGGGGAGGG + Intergenic
991638232 5:68727708-68727730 GTCTGTCACTTCCAGTTGGAAGG + Intergenic
993916310 5:93746034-93746056 CTCTTTCACTGTGAGGTGGGAGG - Intronic
996749960 5:126878387-126878409 CTCAGCCACTGCCAGGTAAAGGG + Exonic
996894761 5:128467268-128467290 CTCTATTCCTGCCAAGTGGAAGG - Intronic
997213277 5:132090410-132090432 TTGTGTCACTGCCAGGTATATGG + Intergenic
997476695 5:134146553-134146575 CTCTGTCACTTTCAGGGGGTAGG - Exonic
999114934 5:149154377-149154399 CTCTGTCTCTGCCAGTTGAAAGG - Intronic
999255361 5:150206922-150206944 CTGTCCCACAGCCAGGTGGAAGG + Intronic
999949980 5:156638255-156638277 CACCCTCACTCCCAGGTGGAAGG + Intronic
1003261703 6:4522588-4522610 CTCTGGCACTGCCGCGTGGTTGG + Intergenic
1004178829 6:13364067-13364089 CTCTTTCTCTACCAGGTGAAGGG + Exonic
1005118870 6:22368786-22368808 CACGGTCACTGTCAGCTGGAGGG + Intergenic
1005521742 6:26607612-26607634 TTCTATCACTGCCAGGGTGAAGG - Intergenic
1005897587 6:30191209-30191231 CTCTGTGACAGACAGGTGGTAGG + Intronic
1007416148 6:41692452-41692474 CTCTGGCAGTGCCAGGTGCCTGG - Intronic
1007749573 6:44063703-44063725 CTCTGTCCCTACCAGCTGTATGG - Intergenic
1010747850 6:79584483-79584505 CTCAGACACTGCCAAATGGAGGG - Intergenic
1012853391 6:104473199-104473221 CCCTGTCAGTGCCAGGTTGGGGG - Intergenic
1018374688 6:163199934-163199956 CTCTATCACTGCCTAGAGGAAGG + Intronic
1018945415 6:168344529-168344551 CTCTGACACTGCCTGGGTGAGGG + Intergenic
1023793438 7:43771697-43771719 CTCTGTGTTTGCCATGTGGATGG - Intronic
1024677545 7:51650605-51650627 CTCACTCATTGCCAGGAGGATGG - Intergenic
1024959426 7:54958713-54958735 CTCTGTGACTACCTGGTGTATGG + Intergenic
1025092705 7:56076907-56076929 CTCTGTCAATGCTTGGTGAAAGG - Intronic
1026165189 7:67903316-67903338 TTCTGTCACTCATAGGTGGATGG - Intergenic
1026277401 7:68892097-68892119 CTCACTCACTGCCATGAGGATGG + Intergenic
1026892685 7:73991778-73991800 CTCTGTCCCAGCCATGAGGAGGG - Intergenic
1027373307 7:77530221-77530243 CTCTGTCACAGCCACGTGTTTGG - Intergenic
1028899554 7:96081652-96081674 CTCTGTGAGTGCCTGGTGGATGG + Intronic
1029687090 7:102156491-102156513 CTCATTCACTGCCAGGAGAATGG + Intronic
1030909335 7:115227226-115227248 GTGTTTTACTGCCAGGTGGATGG + Intergenic
1031339640 7:120583143-120583165 CTCAGTCACTGTCAGGAGCATGG + Intronic
1031614372 7:123864005-123864027 CTCCTTCACTGTCAGGAGGAAGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1035572414 8:681565-681587 CTCTGTCTATGTTAGGTGGAGGG - Intronic
1035683397 8:1506062-1506084 CTATGTGCCTGCCAGGTGGAAGG - Intronic
1035836906 8:2764567-2764589 CTCTGTGGCAGCAAGGTGGAAGG + Intergenic
1042264663 8:66895788-66895810 CTCTCTCACTCCCACATGGATGG + Intronic
1042484677 8:69336956-69336978 CTCCATGACTGCCAGGTGGGAGG + Intergenic
1044422409 8:92012657-92012679 ATCTGTCACTACCAGTTGGGTGG + Intronic
1045389979 8:101705575-101705597 CTCTGTGACTGCCTGGAGTAGGG + Intronic
1046109036 8:109699314-109699336 CTCTGTCACTGCCTGGCCCATGG + Intergenic
1046229174 8:111331090-111331112 GTCTGTCAGGGACAGGTGGAGGG - Intergenic
1048571302 8:135659387-135659409 CCTTGTTCCTGCCAGGTGGAAGG + Intergenic
1048662259 8:136618215-136618237 CTCAGTCACTGTCACATGGATGG + Intergenic
1048779731 8:137987949-137987971 ATGAGGCACTGCCAGGTGGATGG + Intergenic
1048889456 8:138934755-138934777 ATTTGTGACTGCCAGGTAGAGGG + Intergenic
1049184571 8:141242980-141243002 CTCTGTCACCACCCGGTAGATGG - Intronic
1050880714 9:10696678-10696700 CTCTATTACTGCCTGGAGGATGG + Intergenic
1051193343 9:14537022-14537044 CTCTGTTTCTGCCAGGTCCAGGG - Intergenic
1052100754 9:24443351-24443373 CTCTATCACTGCCACATGGTGGG + Intergenic
1053427140 9:38017535-38017557 CTCTGTCCCTGGCAAGTGGCTGG + Intronic
1056732050 9:89174758-89174780 CTCTGAAACTGCCTGCTGGAGGG - Intronic
1057076645 9:92141549-92141571 CCCTGCCACTGCCAGGAGGACGG + Intergenic
1058951554 9:109908431-109908453 CTCTGCCACTTACTGGTGGAAGG + Intronic
1061067136 9:128285573-128285595 CTCAGTCTCTGCCATGTGGCTGG - Intronic
1061892860 9:133631905-133631927 CACTGTCACTGGCAGGCGGCTGG - Intergenic
1062070242 9:134551463-134551485 CTCTGCCCCCTCCAGGTGGAAGG - Intergenic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1186488170 X:9950092-9950114 CTCTGTCACTGCTAGTTGTGTGG + Intergenic
1188078640 X:25808618-25808640 CTCAGTCACTGCCATGGGGCTGG + Intergenic
1189483690 X:41412632-41412654 CTCTGTCCCTACCTGGTGGCAGG + Intergenic
1191747859 X:64509692-64509714 CTCAGTCAGTGCCAGATGTAGGG + Intergenic
1192162724 X:68800605-68800627 CTCTGCCACTTCTGGGTGGATGG + Intergenic
1196508606 X:116478591-116478613 CACTACCACTGCCAGGGGGATGG - Intergenic
1196972423 X:121124200-121124222 CACTGACACTGTCAGGGGGAGGG + Intergenic
1197092909 X:122559652-122559674 CTGTGTCACTCCTAGGTGGATGG - Intergenic