ID: 1070544651

View in Genome Browser
Species Human (GRCh38)
Location 10:77442796-77442818
Sequence GGCCACCTGGTCATTCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 241}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070544651_1070544657 11 Left 1070544651 10:77442796-77442818 CCAAGAGGAATGACCAGGTGGCC 0: 1
1: 0
2: 3
3: 30
4: 241
Right 1070544657 10:77442830-77442852 CATGTTTGACTTTGGTACCTGGG No data
1070544651_1070544655 3 Left 1070544651 10:77442796-77442818 CCAAGAGGAATGACCAGGTGGCC 0: 1
1: 0
2: 3
3: 30
4: 241
Right 1070544655 10:77442822-77442844 GGAGTCAGCATGTTTGACTTTGG No data
1070544651_1070544658 12 Left 1070544651 10:77442796-77442818 CCAAGAGGAATGACCAGGTGGCC 0: 1
1: 0
2: 3
3: 30
4: 241
Right 1070544658 10:77442831-77442853 ATGTTTGACTTTGGTACCTGGGG No data
1070544651_1070544656 10 Left 1070544651 10:77442796-77442818 CCAAGAGGAATGACCAGGTGGCC 0: 1
1: 0
2: 3
3: 30
4: 241
Right 1070544656 10:77442829-77442851 GCATGTTTGACTTTGGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070544651 Original CRISPR GGCCACCTGGTCATTCCTCT TGG (reversed) Intronic
900084641 1:886068-886090 GGCAGCCTGATCCTTCCTCTGGG + Intergenic
900431436 1:2604915-2604937 GGCCACACGGCCCTTCCTCTGGG + Intronic
900790300 1:4675517-4675539 GGCCACATGGTCATTCAACCAGG - Intronic
902845142 1:19104556-19104578 AGCCACCTGGACCTTCCTTTAGG - Intronic
903892818 1:26581275-26581297 GGCCTCCTGCTCACTTCTCTGGG - Intergenic
904038371 1:27570759-27570781 GTCCATCTCCTCATTCCTCTAGG - Intronic
909051601 1:70774387-70774409 GGCGGCCTGCCCATTCCTCTGGG + Intergenic
909677898 1:78257925-78257947 GGCTGCCTGCTCCTTCCTCTGGG - Intergenic
910398485 1:86814556-86814578 AGCTGCCTGATCATTCCTCTGGG - Intergenic
914092945 1:144519998-144520020 CGACACCTGGACACTCCTCTTGG - Intergenic
915659198 1:157388468-157388490 GGCAGCCTGTTCCTTCCTCTGGG + Intergenic
918614718 1:186531534-186531556 GGCAGCCTGCTCCTTCCTCTGGG + Intergenic
920284941 1:204872558-204872580 GGACACTGGGTCATTCCTCCAGG - Intronic
921299907 1:213742051-213742073 CCCCTCCTGGCCATTCCTCTAGG - Intergenic
922692401 1:227705199-227705221 GGCCATGTGGTGATTCCTCAAGG + Intergenic
1062761872 10:28547-28569 GGCGGCCTGTTCCTTCCTCTGGG - Intergenic
1063138656 10:3238216-3238238 GGCCAGCCGGGCATTCCTCCCGG + Intergenic
1063365004 10:5485318-5485340 GTCTTCCTGGTCCTTCCTCTCGG + Intergenic
1064370392 10:14747657-14747679 GGCTGCCTGCTCCTTCCTCTGGG + Intronic
1067272400 10:44803711-44803733 GCCCACATGGCGATTCCTCTGGG + Intergenic
1069643101 10:69969084-69969106 GGACACCTGGTCTTCCCTTTTGG - Intergenic
1069682071 10:70292337-70292359 GGAAACCTGGGCATTCGTCTGGG + Intergenic
1070544651 10:77442796-77442818 GGCCACCTGGTCATTCCTCTTGG - Intronic
1073542005 10:104322379-104322401 GGCCACCTGGTATTCCCTCTGGG + Intronic
1073716690 10:106115374-106115396 GGCTGCCTGCTCCTTCCTCTGGG - Intergenic
1074142637 10:110687947-110687969 GTCCTCCTTGTCCTTCCTCTGGG + Intronic
1075618515 10:123908616-123908638 GGCCACCTGGTCCATCTGCTTGG + Intronic
1075701099 10:124469951-124469973 GGCCTCCTGCTCCTTCATCTGGG - Intronic
1075963442 10:126588467-126588489 GGCAGCCTGTTCTTTCCTCTGGG - Intronic
1076857109 10:133122770-133122792 GGCCTCCTTGTCTTTCCTCCCGG + Intronic
1077784010 11:5362854-5362876 AGCCACCTGGTTGTTACTCTTGG - Intronic
1078033789 11:7781173-7781195 GGCAGCCTGCTCTTTCCTCTGGG - Intergenic
1079256909 11:18838400-18838422 GGGTACCTGCTCCTTCCTCTGGG - Intergenic
1081677209 11:44977261-44977283 GTCCACCTGGGCATTCGTCTGGG - Intergenic
1083513657 11:63235980-63236002 TGCTGCCTGATCATTCCTCTGGG + Intronic
1084189083 11:67490830-67490852 GGCCTCCTGGGCATTCCACACGG - Exonic
1084715427 11:70870451-70870473 GGCCAGCTGGCCCTTCCTCCTGG - Intronic
1086690939 11:89787725-89787747 GGCCACCTTGTTATGCCACTTGG - Intergenic
1086714863 11:90051930-90051952 GGCCACCTTGTTATGCCACTTGG + Intergenic
1088703324 11:112434526-112434548 GGCTGCCTGCTCCTTCCTCTGGG + Intergenic
1090321246 11:125845260-125845282 GGCTGCCTGTTCCTTCCTCTGGG - Intergenic
1090808088 11:130215407-130215429 GGCCACCGGGCCATTCCTCAGGG + Intergenic
1092363798 12:7860384-7860406 GTCCTCCTGGCCATTCCTTTAGG + Intronic
1092756002 12:11764006-11764028 GGCACCCTGGTCATTCATCGTGG - Intronic
1093340383 12:17966949-17966971 GGCTGCCTGTTCTTTCCTCTGGG + Intergenic
1095510258 12:42943816-42943838 GGCTGCCTGCTCCTTCCTCTGGG + Intergenic
1099793180 12:87363034-87363056 GGGCACCTGCTCCTTCTTCTGGG + Intergenic
1100759081 12:97786360-97786382 GCCCATCTGGTCATTCTTATAGG + Intergenic
1101186813 12:102289375-102289397 GGCTGCCTGCTCCTTCCTCTAGG + Intergenic
1101248751 12:102910886-102910908 TGCCTCCTGGTCATGACTCTGGG - Intronic
1101984161 12:109432587-109432609 GGACACCTTTTCATTTCTCTTGG + Intronic
1102457553 12:113080112-113080134 GCCTGCCTGGTCATTCCTCTCGG + Intronic
1102589335 12:113945708-113945730 GGCCGCCAGGGCTTTCCTCTTGG - Intronic
1103175838 12:118862373-118862395 GCCCAGCATGTCATTCCTCTAGG + Intergenic
1104948883 12:132429768-132429790 GGCCATCTGCCCAGTCCTCTCGG - Intergenic
1106759822 13:32857684-32857706 ACTCACCTGGTCTTTCCTCTGGG - Intergenic
1107146766 13:37069094-37069116 GGACACCTGGTCATCCATCCTGG - Intergenic
1107756535 13:43629430-43629452 TACCACCAGGTTATTCCTCTGGG + Intronic
1108173893 13:47772861-47772883 GGCAGCCTGCTCCTTCCTCTGGG + Intergenic
1108988337 13:56622963-56622985 CGCCACCTGAGCATTCCACTTGG + Intergenic
1109650237 13:65314338-65314360 GGCCACTCGGGCAATCCTCTAGG - Intergenic
1111356582 13:87113939-87113961 AGCCACATTTTCATTCCTCTTGG - Intergenic
1112207491 13:97338927-97338949 GGCCACTTGGCCATTACCCTTGG + Intronic
1114682948 14:24502257-24502279 GGCCAGCTCATCATTCCACTAGG - Intronic
1116237220 14:42295237-42295259 GGCAACTTGGTCATTGCTTTTGG + Intergenic
1116428695 14:44820883-44820905 GGCTGCCTGCTCTTTCCTCTGGG - Intergenic
1116671373 14:47846574-47846596 GGCAGCCTGCTCCTTCCTCTGGG - Intergenic
1118777624 14:68983135-68983157 GTCCACCTGGGCATTCTTCATGG - Intergenic
1119805954 14:77482544-77482566 CGCCCTCTGGTCCTTCCTCTGGG - Exonic
1120368921 14:83607502-83607524 GGCTGCCTGCTCCTTCCTCTGGG + Intergenic
1121244049 14:92449949-92449971 AGCCGCCTGGTCATTGGTCTTGG - Intronic
1121431813 14:93893121-93893143 GGCCACCTGGTGGCTACTCTGGG + Intergenic
1124197023 15:27639929-27639951 GGCTGCCTGCTCCTTCCTCTGGG - Intergenic
1126317431 15:47385371-47385393 GGCAACATGGTCTTTGCTCTGGG + Intronic
1126490322 15:49229704-49229726 CACCACCTGGGCATTCCACTAGG - Intronic
1126956321 15:53936657-53936679 GGCAGCCTGCTCCTTCCTCTGGG - Intergenic
1127099931 15:55553808-55553830 GGCAGCCTGCTCCTTCCTCTGGG - Intronic
1128109749 15:65068719-65068741 GGTCCCCTGGTCATTCCCCTTGG + Intronic
1129258018 15:74345210-74345232 GGCCACCCGGTCTTTCTTCCAGG + Exonic
1129566933 15:76633283-76633305 GGCAGCCTGCTCCTTCCTCTGGG + Intronic
1130169801 15:81499318-81499340 GACCACCAAGTCATACCTCTTGG - Intergenic
1130185541 15:81677726-81677748 GGCAGCCTGCTCCTTCCTCTGGG - Intergenic
1131942673 15:97584821-97584843 GGGTGCCTGCTCATTCCTCTGGG + Intergenic
1132859641 16:2063727-2063749 GGCCTCCTGGAAGTTCCTCTGGG + Intronic
1138351502 16:56348444-56348466 GGCCACCTGGACACTGCTGTGGG + Intronic
1138370651 16:56524000-56524022 GACCACCTGGTCATCCATCCTGG - Intergenic
1138882243 16:61030777-61030799 GGCTGCCTGCTCCTTCCTCTGGG + Intergenic
1138997871 16:62475992-62476014 GGCAACCTGATCCTCCCTCTTGG + Intergenic
1139824707 16:69747795-69747817 TTCCACCTCATCATTCCTCTGGG - Intronic
1140670010 16:77269089-77269111 GGCCACCTGCTCCTTCCTCTGGG + Intronic
1140777144 16:78260115-78260137 GGCTGCCTGCTCCTTCCTCTGGG - Intronic
1142115088 16:88352327-88352349 GGCAAATTTGTCATTCCTCTGGG - Intergenic
1142407883 16:89901287-89901309 TGCCACCTGGTCAGACCTCGGGG + Intronic
1143739085 17:8939774-8939796 GGCCACGTTCCCATTCCTCTTGG - Intronic
1144063901 17:11607346-11607368 GGCCACATGGGGATTGCTCTTGG + Intronic
1146655882 17:34634927-34634949 GACCACCTGGTCAGTGCCCTCGG - Exonic
1150317328 17:64180124-64180146 GGCCAGGTGGTCATTGCCCTTGG - Intronic
1150465145 17:65386399-65386421 AGCCTCCTGGTCACTCCTCGTGG + Intergenic
1151937214 17:77269952-77269974 GCCCACCTGGTAGTTCCCCTTGG + Intergenic
1152554275 17:81045320-81045342 GGCCACACGGCCATTCCCCTGGG - Intronic
1152954780 18:28877-28899 GGCGGCCTGTTCCTTCCTCTGGG - Intergenic
1153694567 18:7627197-7627219 AGCCACCCTGTCATTACTCTGGG + Intronic
1154172925 18:12063778-12063800 GGCCACCTGCTCCCTTCTCTAGG - Intergenic
1154413030 18:14151778-14151800 GGCCACCTAGGCACTCCCCTGGG + Intergenic
1156694904 18:39754134-39754156 GGCAGCCTGCTCCTTCCTCTGGG - Intergenic
1157482422 18:48064053-48064075 GGCCACCTTCTCATTCTTCATGG - Intronic
1158423891 18:57322076-57322098 GACCACCTGGCCATGCCTCTTGG - Intergenic
1159235831 18:65671815-65671837 GGCGGCCTGCTCCTTCCTCTGGG - Intergenic
1160233456 18:77066917-77066939 GGCCCCCTGGCCACTCCTCTGGG + Intronic
1160304457 18:77718611-77718633 GGCCTCCTGGTTTTTCCTCAGGG + Intergenic
1161029300 19:2050568-2050590 GGCCGCCGGGTCCTTCCTCCAGG - Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1164572066 19:29381767-29381789 GCCCAGCTGGTCTTTGCTCTGGG + Intergenic
1164599832 19:29553230-29553252 GGCTGCCTGCTCCTTCCTCTGGG - Intronic
1165605667 19:37101775-37101797 GGCCACCAGGACAGTCTTCTGGG - Intronic
926590161 2:14732244-14732266 GGCTCCCTGGCCATTCCTCTAGG - Intergenic
928850112 2:35734941-35734963 GGCAGCCTGCTCCTTCCTCTGGG - Intergenic
931329375 2:61264010-61264032 GGCAACTTGGTCATGCTTCTTGG - Intronic
933052144 2:77612740-77612762 GGCAACCTGCTTCTTCCTCTGGG - Intergenic
933482651 2:82876384-82876406 GGCAGCCTGCTCCTTCCTCTGGG - Intergenic
935877695 2:107529310-107529332 TGCCAGCTGGCCTTTCCTCTTGG - Intergenic
935952568 2:108344726-108344748 GGCTGCCTGCTCATTCCTCTGGG + Intergenic
937225347 2:120365639-120365661 GGCCACCTGCTCACTGCTCATGG - Intergenic
937325221 2:120986210-120986232 TTCCACCTGGTCCTGCCTCTAGG - Intronic
939365019 2:141219717-141219739 GGCTTCCTGTTCCTTCCTCTGGG - Intronic
939511465 2:143110960-143110982 GGCCACCTGGTACTTCCTGTAGG - Intronic
939851415 2:147310929-147310951 GGCAGCCTGCTCCTTCCTCTGGG + Intergenic
940592675 2:155749019-155749041 GGGCGCCTGCTCCTTCCTCTGGG - Intergenic
942232269 2:173871686-173871708 AGCTACCTGATCATTCTTCTGGG + Intergenic
942856603 2:180556110-180556132 GGCAGCCTGCTCCTTCCTCTTGG - Intergenic
945524078 2:210866459-210866481 GGCAACCTGCTCCTTCCTATGGG - Intergenic
946104963 2:217360957-217360979 GGCAACCAGTTCCTTCCTCTAGG - Intronic
946648800 2:221868901-221868923 GGCAGCCTGTTCCTTCCTCTGGG - Intergenic
948725290 2:239930456-239930478 TGTGACCTGGTCATTTCTCTCGG - Intronic
948787456 2:240359772-240359794 GTCCACCTGCTCTCTCCTCTGGG + Intergenic
1168828827 20:833456-833478 GGCCAGCTGGGACTTCCTCTAGG - Intergenic
1171774837 20:29355448-29355470 GGCAACCTGATCCTTCCTCTGGG - Intergenic
1171816846 20:29793078-29793100 GGCAACCTGATCCTTCCTCTGGG - Intergenic
1171901499 20:30862899-30862921 GGCAACCTGATCCTTCCTCTGGG + Intergenic
1172271682 20:33658799-33658821 TGCCACCTGGACCTGCCTCTGGG + Exonic
1173149456 20:40553534-40553556 GGCTGCCTGCTCCTTCCTCTGGG - Intergenic
1174953260 20:55066810-55066832 GGCCGCCTGTTCCTTCCTCTGGG + Intergenic
1174992062 20:55522390-55522412 GGCTGCCTGCTCCTTCCTCTGGG + Intergenic
1175591852 20:60199951-60199973 GGCTGCCTGCTCCTTCCTCTGGG + Intergenic
1176122206 20:63458961-63458983 GGACATTTCGTCATTCCTCTTGG - Intronic
1179218371 21:39386165-39386187 GGCCACCTCCTTTTTCCTCTAGG + Intronic
1180250288 21:46581800-46581822 GGCTGCCTGATCCTTCCTCTGGG + Intergenic
1180320317 22:11313686-11313708 GGCAACCTGATCCTTCCTCTGGG - Intergenic
1180334871 22:11568847-11568869 GGCAACCTGACCCTTCCTCTGGG + Intergenic
1183073111 22:35410111-35410133 GGCCACTTCGTCATCCCCCTAGG + Intronic
1183095556 22:35549886-35549908 GGCCAATTGCTGATTCCTCTGGG + Intronic
1183490069 22:38111339-38111361 GGACACCTCCTCTTTCCTCTAGG - Intergenic
1185368507 22:50447744-50447766 GGCCCCCTGGCCAGTGCTCTGGG - Intronic
950261802 3:11547503-11547525 GGACACGTTGTCATTTCTCTTGG + Intronic
950781507 3:15396823-15396845 TGCTACTTGATCATTCCTCTGGG + Intronic
952574638 3:34759631-34759653 GGCAGCCTGCTCCTTCCTCTGGG - Intergenic
954596192 3:51826995-51827017 TGCTGCCTGGTCATTCTTCTGGG - Exonic
955392493 3:58531638-58531660 GGCCACCTGGGCTCTCCTCCTGG + Intronic
959258791 3:104048701-104048723 GGGTACCTGTTCCTTCCTCTGGG - Intergenic
959883454 3:111473247-111473269 GGCTGCCTGCTCCTTCCTCTGGG + Intronic
960277150 3:115741790-115741812 GGCTGCCTGCTCCTTCCTCTGGG + Intergenic
960482542 3:118211429-118211451 GGCCACCTCTTCTTTCCTCAAGG - Intergenic
962046958 3:131770558-131770580 GGCCTCCTGGAGCTTCCTCTAGG - Intronic
963416185 3:144998785-144998807 GGCAGCCTGCTCTTTCCTCTGGG + Intergenic
965288729 3:166849335-166849357 GGCTGCCTGCTCCTTCCTCTAGG + Intergenic
969299812 4:6291302-6291324 GGCCACCTGCTTCTTCTTCTTGG - Exonic
973589009 4:52421254-52421276 GGCCATCTGGTCTTACCTCCAGG - Intergenic
974339980 4:60603195-60603217 GGCCGCCTGCTTCTTCCTCTGGG + Intergenic
974913164 4:68148222-68148244 GGCTGCCTGCTCCTTCCTCTGGG + Intergenic
975078118 4:70238809-70238831 GGCCATCTGGTGACTCCTATAGG - Intergenic
975497597 4:75051893-75051915 GGCCAACTTGTCTTTCCTCAGGG + Intergenic
977729281 4:100331775-100331797 GGCAACCTGTTCCTCCCTCTGGG - Intergenic
978118572 4:105050643-105050665 GGCAGCCTGCTCCTTCCTCTGGG - Intergenic
979742477 4:124168282-124168304 GGCTGCCTGCTCCTTCCTCTGGG - Intergenic
979751114 4:124279922-124279944 GGCCACCTGGTCTGTCATGTTGG - Intergenic
980022038 4:127722309-127722331 GGCAGCCTGCTCCTTCCTCTGGG + Exonic
980215399 4:129846241-129846263 GGACAGCTGGTCAATCCTCTGGG - Intergenic
980404898 4:132344017-132344039 GGCAGCCTGCTCCTTCCTCTAGG + Intergenic
981273917 4:142875378-142875400 GGCTGCCTGCTCCTTCCTCTGGG - Intergenic
981561883 4:146056807-146056829 AGGCACCTGGTCATTTCACTGGG - Intergenic
982859748 4:160434312-160434334 GGCAGCCTGCTCATTCCTCTGGG + Intergenic
986011816 5:3724087-3724109 GGCTGCCTGCTCCTTCCTCTCGG + Intergenic
987837324 5:23178692-23178714 GGCTGCCTGCTCCTTCCTCTGGG + Intergenic
989348133 5:40453276-40453298 GGGTACCTGCTCCTTCCTCTGGG + Intergenic
991059192 5:62354239-62354261 TGCCACCTGGTGTTTCCTGTGGG + Intronic
993375858 5:87149131-87149153 GGCAGCCTGCTCCTTCCTCTGGG + Intergenic
993420951 5:87700556-87700578 GGCTGCCTGCTCTTTCCTCTGGG + Intergenic
994235194 5:97355319-97355341 GGCAGCCTGCTCCTTCCTCTGGG + Intergenic
994929566 5:106163819-106163841 GCCCAGCTGCTCAATCCTCTAGG - Intergenic
995052305 5:107720020-107720042 GGCTGCCTGCTCCTTCCTCTGGG - Intergenic
995080756 5:108048076-108048098 GGCTGCCTGCTCCTTCCTCTGGG - Intronic
996004515 5:118404877-118404899 GGCTGCCTGCTCCTTCCTCTGGG + Intergenic
997355102 5:133257450-133257472 GGTTACCTGGGCATCCCTCTAGG + Intronic
997521875 5:134528181-134528203 GGCCGCCTGGCCCCTCCTCTCGG + Intronic
997526370 5:134555593-134555615 GGCCACCTGGCCAAGCCTCTTGG - Intronic
998613528 5:143715062-143715084 GCACACCAGTTCATTCCTCTGGG + Intergenic
999115177 5:149156534-149156556 CACCACTTGGTCATTCCACTAGG + Intronic
1001398868 5:171435097-171435119 GGCCACCTTGGCATGGCTCTGGG - Intronic
1001961667 5:175883579-175883601 GTCCACCTGCTCCATCCTCTAGG + Exonic
1002644029 5:180644436-180644458 GTCCACCTGGCCAGCCCTCTAGG + Intronic
1003964876 6:11243191-11243213 GGCCTCCTGCTCAGTCCTCCAGG + Intronic
1006192371 6:32217459-32217481 GGCAAGCTGGTCAACCCTCTAGG + Intronic
1006712244 6:36083981-36084003 GGCTGCCTGTTCCTTCCTCTGGG - Intronic
1006983062 6:38161216-38161238 GGTCACGTGGTGATTCCTTTTGG - Intergenic
1007133484 6:39498891-39498913 AGCCACCTGGCCTTTCCTGTGGG + Intronic
1007929664 6:45678976-45678998 TGCCACCTGGTCATCCCTGTTGG + Intergenic
1010613531 6:77985191-77985213 GGGCACCTGAGCACTCCTCTTGG + Intergenic
1011214225 6:84987744-84987766 GGCAATCTGCTCCTTCCTCTGGG - Intergenic
1012572203 6:100742929-100742951 GTCCACCTGGACATTCCCCTAGG - Intronic
1013932059 6:115545764-115545786 GGCTGCCTGCTCCTTCCTCTGGG - Intergenic
1014564293 6:122929905-122929927 GGCAGCCTGCTCCTTCCTCTGGG + Intergenic
1018459570 6:163985133-163985155 GGCCACCAGGTCAGTTTTCTGGG - Intergenic
1020139209 7:5603576-5603598 GGCCAGCTGCCCATTCTTCTTGG - Exonic
1022566903 7:31412930-31412952 GGCCACCTCATGATTCCCCTCGG + Intergenic
1024034303 7:45494812-45494834 GGCTGCCTGCTCCTTCCTCTGGG + Intergenic
1026233166 7:68503142-68503164 GTCCTCCTGGTCATTTCACTAGG + Intergenic
1031008349 7:116499458-116499480 GGCCTCCTGGTCACCCTTCTGGG - Exonic
1031918279 7:127583172-127583194 GGCCAGCTGGTCCTTCTGCTTGG + Exonic
1032383410 7:131505862-131505884 GCTTACCTGGTCCTTCCTCTGGG + Exonic
1032920002 7:136534556-136534578 GGTTACCTGCTCTTTCCTCTGGG - Intergenic
1033770575 7:144546778-144546800 GGCCTCCTGGTCATGCTTCCTGG + Intronic
1033989489 7:147265793-147265815 GGCTTCCTGCTCCTTCCTCTGGG - Intronic
1034255113 7:149720554-149720576 GCCCGCCTGGGCATTCCCCTGGG + Intronic
1034647899 7:152664761-152664783 GGCCACCTGGACATTCCTTGGGG - Intronic
1034894676 7:154868783-154868805 GCCCACCAGGTCGTTACTCTTGG + Intronic
1038595706 8:28883892-28883914 GGCCACCAAGTCATTCCACATGG - Intronic
1039300117 8:36200583-36200605 GGCTGTCTGATCATTCCTCTGGG + Intergenic
1039331623 8:36543518-36543540 GGCCACCTGGTAATGGCCCTGGG - Intergenic
1042644273 8:70968800-70968822 AGCAACCTGCTCATTCCTCTGGG + Intergenic
1044505069 8:93007135-93007157 GGCTGCCTGATCCTTCCTCTGGG - Intronic
1046657625 8:116912729-116912751 GGCTGCCTGCTCCTTCCTCTGGG + Intergenic
1047511534 8:125519765-125519787 GGACACCTTGTCAGGCCTCTGGG + Intergenic
1048178025 8:132170378-132170400 CGCCACCAGGTCAATCCTGTTGG + Exonic
1049508004 8:143014060-143014082 GGCCACCGGCTCATTCTTCATGG + Intergenic
1051127408 9:13820374-13820396 GGCTACCTGGTCATTCATGAGGG - Intergenic
1052061463 9:23966010-23966032 TGCTACCTGTTCCTTCCTCTGGG + Intergenic
1052833462 9:33233785-33233807 GCCCACCTGCCCATTCCACTTGG - Intronic
1052943375 9:34147891-34147913 GACGACCTGGCCATTACTCTAGG + Intergenic
1055509717 9:76984406-76984428 GGCAGCCTGCTCCTTCCTCTGGG + Intergenic
1058530279 9:105899780-105899802 GGCTGCCTGTTCCTTCCTCTGGG + Intergenic
1058756037 9:108084090-108084112 GGCCTCCTGTTCAGTCTTCTAGG - Intergenic
1058756083 9:108084391-108084413 AGCCACCTGGTCATGAATCTAGG + Intergenic
1059004125 9:110383430-110383452 GGCTGCCTGCTCTTTCCTCTGGG + Intronic
1059262623 9:112993409-112993431 GGCTGCCTGCTCCTTCCTCTGGG + Intergenic
1060340218 9:122768414-122768436 GGCCACCTGCTCCTTCCTCTGGG - Intergenic
1061059389 9:128243084-128243106 GGCACCCTGGTCATTTCCCTTGG - Intronic
1061478985 9:130887106-130887128 GGCCACCTGCCCACTGCTCTCGG - Intronic
1062743076 9:138192395-138192417 GGCGGCCTGTTCCTTCCTCTGGG + Intergenic
1062743325 9:138194396-138194418 GGCGGCCTGTTCCTTCCTCTGGG + Intergenic
1062743574 9:138196397-138196419 GGCGGCCTGTTCCTTCCTCTGGG + Intergenic
1203368536 Un_KI270442v1:279440-279462 GGCAACCTGATCCTTCCTCTGGG - Intergenic
1186740921 X:12517564-12517586 GGCTGCCTGCTCCTTCCTCTGGG + Intronic
1188099842 X:26070885-26070907 GGCAGCCTGCTCCTTCCTCTGGG + Intergenic
1190177314 X:48161625-48161647 GGCCAGCTGGTCCTTCCTGTTGG - Intergenic
1190975614 X:55397311-55397333 TGCTGCCTGATCATTCCTCTGGG - Intergenic
1190979581 X:55443998-55444020 TGCTACCTGATCCTTCCTCTGGG - Intergenic
1191034457 X:56009227-56009249 GGCTGCCTGCTCCTTCCTCTGGG - Intergenic
1192209820 X:69120617-69120639 CCCCACCTGGCCATTCCTATCGG - Intergenic
1192920769 X:75703447-75703469 GGCAGCCTGGCCCTTCCTCTGGG - Intergenic
1192923609 X:75733883-75733905 GGCAGCCTGTTCCTTCCTCTGGG + Intergenic
1193478490 X:81996646-81996668 GGCTGCCTGTTCCTTCCTCTGGG - Intergenic
1193533555 X:82686187-82686209 GGCCACCTGCTCCTTCCTCTGGG + Intergenic
1193906469 X:87251721-87251743 GGCCAACAGGTCATTTTTCTTGG + Intergenic
1194330627 X:92580098-92580120 GGCTGCCTGCTCCTTCCTCTGGG + Intronic
1194580690 X:95666611-95666633 GGCAGCCTGGTCCTTCCTCTGGG - Intergenic
1194930484 X:99881285-99881307 GGCTGCCTGTTCCTTCCTCTGGG - Intergenic
1195812747 X:108851971-108851993 GGCTGCCTGTTCTTTCCTCTAGG - Intergenic
1196284435 X:113863434-113863456 GGCCACCTGCTTCTTCCTCTGGG + Intergenic
1196599976 X:117590236-117590258 GGCTACCTGCTCCTTCCTCTGGG - Intergenic
1196694144 X:118593095-118593117 GGCCACTTGGCCAGTCCTTTAGG + Intronic
1197756115 X:129996088-129996110 GGCCACCTCATCATTCCACTTGG - Intronic
1199173293 X:144756990-144757012 GGCAGCCTGTTCCTTCCTCTGGG + Intergenic
1200639333 Y:5699168-5699190 GGCTGCCTGCTCCTTCCTCTGGG + Intronic
1201070160 Y:10140862-10140884 GGCAACCTGATCCTTCCTCTGGG + Intergenic
1202188555 Y:22216526-22216548 TGACACATGGTCATTTCTCTGGG - Intergenic