ID: 1070545714

View in Genome Browser
Species Human (GRCh38)
Location 10:77450865-77450887
Sequence CAGGGGTAACAGAATGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070545704_1070545714 3 Left 1070545704 10:77450839-77450861 CCCATGTGTTGTAGGAGGGACCC 0: 36
1: 907
2: 2616
3: 4336
4: 5574
Right 1070545714 10:77450865-77450887 CAGGGGTAACAGAATGATGGGGG No data
1070545700_1070545714 23 Left 1070545700 10:77450819-77450841 CCTCTTGAATTGTAATAATTCCC 0: 1
1: 14
2: 5
3: 11
4: 181
Right 1070545714 10:77450865-77450887 CAGGGGTAACAGAATGATGGGGG No data
1070545705_1070545714 2 Left 1070545705 10:77450840-77450862 CCATGTGTTGTAGGAGGGACCCA 0: 29
1: 765
2: 1827
3: 3592
4: 4849
Right 1070545714 10:77450865-77450887 CAGGGGTAACAGAATGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070545714 Original CRISPR CAGGGGTAACAGAATGATGG GGG Intronic
No off target data available for this crispr