ID: 1070549497

View in Genome Browser
Species Human (GRCh38)
Location 10:77480060-77480082
Sequence CCTGCAGCCAAGACAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070549494_1070549497 -2 Left 1070549494 10:77480039-77480061 CCGTCTCATGGGCAGACCTGGCC No data
Right 1070549497 10:77480060-77480082 CCTGCAGCCAAGACAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070549497 Original CRISPR CCTGCAGCCAAGACAGAAGC TGG Intronic
No off target data available for this crispr