ID: 1070551025

View in Genome Browser
Species Human (GRCh38)
Location 10:77490936-77490958
Sequence AGGGCTCCTACAGTAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070551025_1070551033 13 Left 1070551025 10:77490936-77490958 CCAGGGCCTACTGTAGGAGCCCT 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1070551033 10:77490972-77490994 GTAGGAGCCAGGCCCACATCAGG No data
1070551025_1070551027 -5 Left 1070551025 10:77490936-77490958 CCAGGGCCTACTGTAGGAGCCCT 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1070551027 10:77490954-77490976 GCCCTAATCAGCCCTACTGTAGG No data
1070551025_1070551030 2 Left 1070551025 10:77490936-77490958 CCAGGGCCTACTGTAGGAGCCCT 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1070551030 10:77490961-77490983 TCAGCCCTACTGTAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070551025 Original CRISPR AGGGCTCCTACAGTAGGCCC TGG (reversed) Intronic
900564161 1:3324215-3324237 AGGACTCCCACAGTGGGGCCTGG + Intronic
900957737 1:5897972-5897994 AGGGCTCTCGCAGAAGGCCCGGG + Intronic
903207664 1:21795068-21795090 ACGCCTCCTGCAGCAGGCCCGGG - Intergenic
904337951 1:29810247-29810269 CGGTCCCCTCCAGTAGGCCCAGG - Intergenic
905662339 1:39737186-39737208 AGTGCTCTGACACTAGGCCCAGG - Intronic
908903541 1:68982955-68982977 AGGGCTCCTACCCTATACCCAGG - Intergenic
914997868 1:152560719-152560741 AGGGTTTCTTCAGTAGACCCTGG + Intronic
915340351 1:155173889-155173911 TGGGCTCCTGCATTAAGCCCGGG + Intronic
1067733015 10:48826802-48826824 AGTGCTCCTGCAGAAAGCCCAGG - Exonic
1070551025 10:77490936-77490958 AGGGCTCCTACAGTAGGCCCTGG - Intronic
1075965806 10:126610372-126610394 AGGGCTCAGACAGGAGCCCCAGG + Intronic
1077357054 11:2123282-2123304 AGGGGTCAGACAGAAGGCCCTGG - Intergenic
1078294794 11:10057155-10057177 AGGGCTGCTACAGTATGCTTGGG - Intronic
1081581095 11:44352711-44352733 AGGGCTCCAACATTATCCCCAGG + Intergenic
1083859319 11:65411547-65411569 AGGAGCCCTACAGGAGGCCCTGG - Exonic
1086686111 11:89734756-89734778 AGAGGTCCTACAGCAGCCCCAGG + Intergenic
1086700426 11:89895580-89895602 AGGGGTCCTCCAGCAGCCCCAGG - Intergenic
1086705743 11:89948946-89948968 AGGGGTCCTCCAGCAGCCCCAGG + Intergenic
1087406060 11:97732203-97732225 AGGGCTGCTACAGTTGGCTGGGG - Intergenic
1094384103 12:29874978-29875000 AGAGCACCTACATCAGGCCCTGG - Intergenic
1100411238 12:94321912-94321934 AGGGCTGCTACAGTATGCTGGGG + Intronic
1102946898 12:116997716-116997738 AGGGCTCCTGCAGCAGCCCAGGG - Intronic
1103316583 12:120060995-120061017 AGGGCTCCCTCAGTAGGGTCTGG + Intronic
1107310628 13:39073633-39073655 AGTGCCCCAACAGTAGGCACTGG + Intergenic
1108832777 13:54500056-54500078 AGGGCTGCTCCAGCAGACCCAGG + Intergenic
1122834748 14:104425198-104425220 AGGGCTCCTAGGGGATGCCCAGG - Intergenic
1202854968 14_GL000225v1_random:44271-44293 AGGGATCCCACAGTCGGCACAGG + Intergenic
1202875297 14_GL000225v1_random:201840-201862 AGGGGTCCTCCAGGAGGCCTAGG + Intergenic
1124649613 15:31465161-31465183 GGGGCTCCTACAGTGAGCCCAGG - Intergenic
1127654991 15:61047256-61047278 AGGGCTTCTGCAGGGGGCCCAGG - Intronic
1127827666 15:62719159-62719181 TGGGCTCCTACAGTGTGCCTTGG - Intronic
1129372309 15:75105247-75105269 AGGACTCCAAGAGTAGGACCTGG - Intronic
1130581212 15:85138107-85138129 AGAGCTCCTGCAGCAGGCCCAGG - Exonic
1132326454 15:100973916-100973938 AGGCCTCCTCCAGCAGGTCCCGG - Exonic
1132942908 16:2517143-2517165 GGGGCTCCCACTGCAGGCCCAGG - Intronic
1133814744 16:9188100-9188122 AGGGCTCCCACAGCAGGCTGAGG + Intergenic
1134042865 16:11081468-11081490 AGGGCTCCTCCAGGTAGCCCTGG + Intronic
1134453758 16:14379203-14379225 AGGGCTCCTTCCGATGGCCCAGG - Intergenic
1136778523 16:32883882-32883904 AGAGGTGCTACAGTAGCCCCTGG + Intergenic
1136892097 16:33977632-33977654 AGAGGTGCTACAGTAGCCCCTGG - Intergenic
1138625020 16:58244658-58244680 AGGGAACCCACAGTAGGCCTTGG - Intronic
1141764809 16:86051474-86051496 AGGGCTCCTCCCGTGGGCCCAGG + Intergenic
1203080940 16_KI270728v1_random:1145976-1145998 AGAGGTGCTACAGTAGCCCCTGG + Intergenic
1145265911 17:21379524-21379546 AGGGCTCCAAGGGCAGGCCCGGG - Intronic
1146673523 17:34757835-34757857 GAGGCTCCTACGGTAAGCCCAGG + Intergenic
1150390118 17:64785092-64785114 TGGCCTCCTACAGAAAGCCCAGG - Intergenic
1155819962 18:30362427-30362449 ACGCCTCCTGCAGCAGGCCCAGG + Intergenic
1157621187 18:49018309-49018331 AGGGCCCCTTCAGCAGGCCTTGG + Intergenic
1160918016 19:1506910-1506932 TGGGCTCCTGCAGGAGGACCTGG + Exonic
1166586171 19:43951326-43951348 AGGGTTCCGAGAGTAGGTCCAGG - Exonic
1167796608 19:51713568-51713590 AGGGCCGCTCCAGTCGGCCCTGG + Exonic
1168288883 19:55347504-55347526 AGGGCTCCTTCTGGAGGTCCTGG - Exonic
927883976 2:26707252-26707274 ACGGCTCCCACAGTAGTCCCTGG + Intronic
927964839 2:27262394-27262416 AGAGCTCCCTCTGTAGGCCCCGG - Intronic
930875484 2:56210742-56210764 AGGGCTCCTACAGTGTGGCTCGG + Intronic
933649678 2:84840510-84840532 AGGGCCCCTACAGGAGGTCAGGG - Intronic
934623248 2:95829218-95829240 AGGGCTGCTGCAGTATGCCCAGG + Intergenic
934810518 2:97272874-97272896 AGGGCTGCTGCAGTATGCCCAGG - Intergenic
934827174 2:97435065-97435087 AGGGCTGCTGCAGTATGCCCAGG + Intergenic
935012460 2:99148488-99148510 TAGGCTACTACAGTAGACCCAGG + Intronic
939580540 2:143941096-143941118 AGGGCTCTTTCAGTAGGCTGTGG - Exonic
943524328 2:188997378-188997400 AGTGAACTTACAGTAGGCCCTGG - Exonic
944133195 2:196369659-196369681 AGGTTTCCTACTCTAGGCCCTGG - Intronic
944996251 2:205297535-205297557 AGGGCTCCTACAGAAGGTCAAGG - Intronic
947180243 2:227405016-227405038 AGGGCCTCTGCAGGAGGCCCTGG - Intergenic
948828498 2:240586103-240586125 TGGGCTCCTAACGAAGGCCCTGG + Intergenic
1169252447 20:4071065-4071087 GAGGCTGCTGCAGTAGGCCCAGG + Intronic
1169865292 20:10193747-10193769 AGGGCTCCAAGAGTAAGCACAGG - Intergenic
1171035031 20:21707214-21707236 AGGTCTCTTACAAAAGGCCCAGG - Intronic
1172767256 20:37357374-37357396 AGGGCACCCACAGTAGGCCTGGG - Intronic
1175586369 20:60143800-60143822 TGGCCTCCTGCACTAGGCCCTGG - Intergenic
1176262381 20:64188816-64188838 AGGGCTCCCACCGCAGGCTCCGG - Intronic
1176272411 20:64242920-64242942 AGTGCTCCTAGAGTAAGACCTGG + Intergenic
1179600169 21:42472133-42472155 AGGGCCCCCACAGTGGGCCTGGG + Intergenic
1181429135 22:22867143-22867165 AGGGCACCTCCAGTAGGGCTGGG - Intronic
1182489507 22:30661771-30661793 TGGACTCCATCAGTAGGCCCTGG - Intronic
1183228705 22:36567567-36567589 AGGGCTCCTACAGTTGGGGGTGG + Intronic
1183828354 22:40405375-40405397 AGGGGTCCTGGAGGAGGCCCTGG - Intronic
1183984109 22:41560195-41560217 AGGCCTCCTCCAGCTGGCCCTGG + Intergenic
1184644132 22:45886927-45886949 CGGGGTCCTACAACAGGCCCTGG - Intergenic
952267590 3:31801536-31801558 AGGCCTCCCACAGCAGGCCCAGG + Intronic
952517834 3:34123967-34123989 AGGTTTCCTACTCTAGGCCCTGG - Intergenic
953845846 3:46425631-46425653 AGGGCTGCTACAGTGTGCTCTGG - Intergenic
955894722 3:63686996-63687018 AGGGCTGGAACACTAGGCCCAGG + Intergenic
961832686 3:129632309-129632331 AAGGGTCCTCCAGGAGGCCCAGG + Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
965085977 3:164098860-164098882 ACCTCCCCTACAGTAGGCCCCGG + Intergenic
982099474 4:151953956-151953978 AGGGCTCCTATGGAAGGCCAGGG + Intergenic
985694837 5:1334214-1334236 AGGACCCCTGCAGGAGGCCCGGG + Intronic
985774528 5:1833907-1833929 AGGGATCCACCAGTGGGCCCCGG + Intergenic
998128851 5:139641053-139641075 AGAGCCCCCACAGCAGGCCCTGG + Intergenic
1007750552 6:44068312-44068334 CGGGCTCCTGCACCAGGCCCTGG - Intergenic
1010004737 6:70983439-70983461 AGGACTCCAACAGTGGGGCCAGG - Intergenic
1010185169 6:73135525-73135547 AGGGCCCCTAGAGTAGGGGCAGG - Intronic
1015646232 6:135391773-135391795 AGGGCTACTGCAGTAGGTACAGG + Intronic
1020614127 7:10437255-10437277 AGGGCCTCTACTGTAGGCCCTGG - Intergenic
1020771812 7:12404445-12404467 AGAGCTCTTACAGTTGTCCCAGG + Intergenic
1022377531 7:29828659-29828681 GGGGCTCCTACTGCAGACCCAGG + Intronic
1024054766 7:45652919-45652941 TGGGCTCCTGCAGATGGCCCTGG + Intronic
1024704010 7:51938172-51938194 AGGCCTGCTCCAGTAGACCCAGG - Intergenic
1027977617 7:85179188-85179210 AGTGCCCCTACAGGAGGCTCTGG - Intronic
1029052147 7:97700472-97700494 AGGGCTGCTACGGTAGGCTGGGG - Intergenic
1034309795 7:150077340-150077362 ATACCTCCTACAGTAGGCTCTGG - Intergenic
1034391620 7:150791857-150791879 AGGGCGGCGACAGTTGGCCCAGG + Intronic
1034547578 7:151799076-151799098 AGGGCACCCGCAGCAGGCCCGGG - Intronic
1037973466 8:23191887-23191909 AGAGCTGGTACAGCAGGCCCAGG - Exonic
1039102627 8:33957489-33957511 AGGGCTTCTACTGGAGACCCAGG + Intergenic
1047724290 8:127670748-127670770 AGGGCTCTTACAGTTGTCCCAGG + Intergenic
1047765352 8:127985904-127985926 AGGGCTCCTACCCTAGCCCTTGG + Intergenic
1049600682 8:143506012-143506034 ATGGCGCCGACAGGAGGCCCTGG + Intronic
1051261882 9:15272561-15272583 AGTGCTACTACTGTAGGGCCTGG + Intronic
1054902625 9:70385999-70386021 TGGGCTCCTGCAGTGGGCGCGGG - Exonic
1055022117 9:71681386-71681408 AAGGATGCTTCAGTAGGCCCTGG - Intergenic
1056515296 9:87343991-87344013 AGGGCTCCTCCAGCAGCTCCTGG + Intergenic
1056821633 9:89846129-89846151 CGGGATGCCACAGTAGGCCCAGG + Intergenic
1060719477 9:125965873-125965895 ACTTCTCCTACAGAAGGCCCAGG + Exonic
1061913789 9:133738600-133738622 AGGGTTGCTGCAGTAGACCCAGG + Intronic
1062004602 9:134232939-134232961 AGGGGTCCTTGAGTAGCCCCTGG - Intergenic
1062067036 9:134534095-134534117 AGGGCTCTCACCGCAGGCCCAGG - Intergenic
1062179898 9:135185683-135185705 AAAGCTCCTACAGCAGGTCCTGG - Intergenic
1186883029 X:13885520-13885542 AGGACTCCTAGAGGTGGCCCTGG + Intronic
1188087878 X:25923904-25923926 AGGCCTCCTACGGTATGCACAGG + Intergenic
1192382924 X:70636367-70636389 AGGCCTGCTGCAGTAGGCCAAGG + Intronic
1195739305 X:108046450-108046472 AGGGCTGATGCAGAAGGCCCAGG - Intronic