ID: 1070552868

View in Genome Browser
Species Human (GRCh38)
Location 10:77504543-77504565
Sequence ATAAAGAAACTGTCTGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070552868_1070552870 28 Left 1070552868 10:77504543-77504565 CCACAAGCAGACAGTTTCTTTAT 0: 1
1: 0
2: 2
3: 39
4: 364
Right 1070552870 10:77504594-77504616 TTGTTATATTTTTAGAGACAGGG No data
1070552868_1070552869 27 Left 1070552868 10:77504543-77504565 CCACAAGCAGACAGTTTCTTTAT 0: 1
1: 0
2: 2
3: 39
4: 364
Right 1070552869 10:77504593-77504615 TTTGTTATATTTTTAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070552868 Original CRISPR ATAAAGAAACTGTCTGCTTG TGG (reversed) Intronic
900929331 1:5726390-5726412 ACACAGAGACTGTCTGCTGGGGG + Intergenic
900929426 1:5726894-5726916 ACACAGAGACTGTCTGCTGGGGG - Intergenic
904372069 1:30054840-30054862 ATAAATAAACTGCCTGGTTACGG + Intergenic
905565175 1:38958601-38958623 ATACAAAAACTGGCTGGTTGTGG - Intergenic
907728659 1:57044626-57044648 GTAAAGACACTTTCTGCTTTTGG - Intronic
910627401 1:89322721-89322743 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
910730775 1:90393444-90393466 ATACAGGAAGTGCCTGCTTGTGG + Intergenic
910756545 1:90699164-90699186 TTAAAGAAAGTGTCAGCTGGGGG - Intergenic
911127333 1:94352788-94352810 ATAAAGATAATGTTTGCTTCTGG + Intergenic
911612840 1:99975902-99975924 ATAAAAAAATTATCTGGTTGTGG + Intronic
911721729 1:101198448-101198470 AAAAAGTCACAGTCTGCTTGGGG - Intergenic
913563327 1:120045701-120045723 ATTAAAAAACTGTATACTTGAGG - Intronic
913634795 1:120747879-120747901 ATTAAAAAACTGTATCCTTGAGG + Intergenic
914283925 1:146205062-146205084 ATTAAAAAACTGTATCCTTGAGG - Intronic
914544956 1:148655801-148655823 ATTAAAAAACTGTATCCTTGAGG - Intronic
914621614 1:149414887-149414909 ATTAAAAAACTGTATCCTTGAGG + Intergenic
915166236 1:153949196-153949218 ATAATGAGACTGCCTGCCTGGGG + Exonic
915264113 1:154703219-154703241 CAATAGTAACTGTCTGCTTGTGG - Exonic
915777603 1:158507461-158507483 GAAAAGAATCTGTGTGCTTGGGG - Intergenic
916788125 1:168101259-168101281 CTAAAGAAACTGGCTGCATTAGG - Intronic
917840708 1:178975180-178975202 AGACAGAAACTGCCTGCTTGGGG + Intergenic
918476324 1:184928652-184928674 AGACAGAATCTGTATGCTTGGGG - Intronic
918854262 1:189730104-189730126 AGAAAGAACCTGTGTGCTTTGGG - Intergenic
918892713 1:190295776-190295798 AGAGAGAAACTGGCTGCTTGGGG - Intronic
920023575 1:202975217-202975239 ATAAAGATAATGTCTCCCTGTGG - Intergenic
920360760 1:205414578-205414600 ATAAAAAAACTGGCTGGGTGTGG - Intronic
921295388 1:213696532-213696554 AAAAAGAAACTCTCTTCTTAGGG + Intergenic
921851320 1:219934894-219934916 ATAGAGAAACCCTGTGCTTGGGG + Intronic
923065232 1:230511280-230511302 TTAAAGAAGCTGTCTCTTTGGGG + Intergenic
924516327 1:244769035-244769057 AAAGAGAACCTGTGTGCTTGGGG - Intergenic
1063043981 10:2372961-2372983 AACAAGAAACTGTCTGGTTTGGG + Intergenic
1064352319 10:14587576-14587598 CTAAAGAAACTGTCTTTTTTTGG - Intronic
1064861848 10:19835219-19835241 ATAAAAAACCTGTCTGGGTGCGG - Intronic
1065638871 10:27760114-27760136 ATAATGAGACTGTGTGCTTAGGG - Intergenic
1067546972 10:47199141-47199163 ATCAAGAAACAGTCTGATTTTGG - Intergenic
1069308659 10:67005369-67005391 AGATAGAGAATGTCTGCTTGGGG - Intronic
1070552868 10:77504543-77504565 ATAAAGAAACTGTCTGCTTGTGG - Intronic
1072058665 10:91787361-91787383 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1072779456 10:98236742-98236764 AGAAAGAAAAACTCTGCTTGTGG - Intronic
1073575694 10:104621039-104621061 ATAACAAAAGTGTCTGTTTGTGG - Intergenic
1074567449 10:114593592-114593614 ATAAAGATAATGTCTGCCTCTGG - Intronic
1074568126 10:114600153-114600175 ATTAAGCAGCTGTCTGATTGTGG - Intronic
1077812390 11:5651295-5651317 ATAAGTAAACTGTGTGCTTTGGG + Intergenic
1078748502 11:14137946-14137968 ATAAATCAATTGTGTGCTTGCGG - Intronic
1079503485 11:21128830-21128852 AAAAATAAACAGTTTGCTTGAGG - Intronic
1079723303 11:23846609-23846631 GGACAGAATCTGTCTGCTTGGGG - Intergenic
1081264537 11:41003954-41003976 ATAAAGAAAGAGTGTGCTTATGG + Intronic
1081460217 11:43265928-43265950 AAAAAGAAATTGTGTCCTTGAGG - Intergenic
1081757863 11:45557316-45557338 CAAAAGAAAATGTCTGCTGGGGG + Intergenic
1082170195 11:48994939-48994961 CTAGAGAAACTGTCTCCTTGTGG + Intergenic
1082607682 11:55261829-55261851 CTAGAGAAACTGTCTCCTTGTGG - Intergenic
1084907150 11:72356983-72357005 AGGAAGAAGCTTTCTGCTTGGGG + Intronic
1085147196 11:74212172-74212194 AGAGAGAATCTGTGTGCTTGTGG + Intronic
1085492887 11:76937683-76937705 ATAATGAAACTGTCTACTGCAGG + Intronic
1085883607 11:80496749-80496771 ATACAGATACCCTCTGCTTGAGG - Intergenic
1086547618 11:88016438-88016460 ATAAAGATAATTTTTGCTTGTGG + Intergenic
1086666716 11:89491950-89491972 ATAAAGAAACTGGCGGCTGGTGG - Intronic
1086695622 11:89841698-89841720 CTAGAGAAACTGTCTCCTTGTGG - Intergenic
1086702938 11:89920760-89920782 CTAGAGAAACTGTCTGCTTGTGG + Intronic
1086710532 11:90002785-90002807 CTAGAGAAACTGTCTCCTTGTGG + Intergenic
1087032140 11:93716306-93716328 AGAGAGAATCTGTATGCTTGGGG - Intronic
1088674524 11:112179603-112179625 ATAAAGAAACTGTAGCCTAGAGG + Intronic
1089480595 11:118801605-118801627 ATAAAGAAATTAGCTGCATGTGG - Intergenic
1090078962 11:123598072-123598094 TTAAAGATGCTGTCTCCTTGTGG - Intronic
1090246399 11:125218892-125218914 AGAAAGAACCTGGGTGCTTGTGG - Intronic
1090937094 11:131352919-131352941 AGAAAGAAAATCTCTTCTTGTGG + Intergenic
1090994522 11:131853211-131853233 AAAAAGAAATAGTCTGCTTATGG - Intronic
1091292070 11:134446388-134446410 ATAAAGACACTGTATGGTTGTGG - Intergenic
1091485948 12:888564-888586 AGAAGGAAGCTGTGTGCTTGCGG + Intronic
1091518718 12:1213579-1213601 ATACAGAAACTGCCTGGTTGTGG + Intronic
1092521305 12:9276163-9276185 ATTAAGAACCTCTCTGCATGCGG + Intergenic
1094028969 12:25988872-25988894 TTAGAGAAACTGTCTCCTGGAGG + Intronic
1097357291 12:58616033-58616055 ATAAATAAACTTTCTATTTGGGG + Intronic
1098099493 12:66999067-66999089 ATGAAGAAAATGTCTGAATGTGG - Intergenic
1099101016 12:78440118-78440140 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
1099283434 12:80683622-80683644 TTTAAAAAACTGTCTTCTTGAGG - Intergenic
1099287136 12:80727554-80727576 ATAAAGAGATTGACTGTTTGGGG + Intergenic
1099965102 12:89437605-89437627 ATAAAGAAACTATATGGTGGGGG - Intronic
1100868474 12:98884821-98884843 AAAAAGAAACTATCTATTTGGGG + Intronic
1100904804 12:99285732-99285754 AGAGAGAATCTGTGTGCTTGGGG + Intronic
1101061145 12:100973623-100973645 ATAAAGAAACTGTAGGCTGGGGG - Intronic
1102266511 12:111490786-111490808 AGAAAGAATCTGTGTGCTCGGGG + Intronic
1102382112 12:112475627-112475649 ATAGAAAAACTGTGTGATTGGGG + Intronic
1105651814 13:22386962-22386984 ATGAAGAGACAGGCTGCTTGGGG + Intergenic
1107467418 13:40664337-40664359 AGTGAGAAACTGTCAGCTTGGGG + Intronic
1107589702 13:41890136-41890158 GTAAAGAAACAGACTGCTTCTGG + Intronic
1107899951 13:45002044-45002066 AACAAAAAACTGTCAGCTTGTGG - Intronic
1108246057 13:48515435-48515457 ATAAAGAAGCAGTTTGCTTAAGG - Intronic
1108833973 13:54517085-54517107 TTAAAGAAATTGTCTACATGGGG + Intergenic
1109336784 13:61004297-61004319 AGACAGAATCTGTGTGCTTGGGG - Intergenic
1110873475 13:80480179-80480201 GTAAAAATATTGTCTGCTTGAGG - Intergenic
1111129751 13:83959856-83959878 ACAGATAAACTGTCTGCTTCTGG + Intergenic
1111303405 13:86373907-86373929 ATAAAGAATCCTTCTGCTTGAGG - Intergenic
1111572187 13:90103601-90103623 ACAAAGAATCTGTTTGCTTGGGG - Intergenic
1111583455 13:90253766-90253788 AGAGAGAACCTGTGTGCTTGGGG - Intergenic
1111674298 13:91367946-91367968 CTAAGGAAGGTGTCTGCTTGAGG + Intergenic
1112379154 13:98872239-98872261 ATTAAGAAACTTTCTCTTTGTGG + Intronic
1112486491 13:99825074-99825096 ATGAAGTGACTGTCTGCTTATGG - Intronic
1112708222 13:102096991-102097013 ATGAAATAACTGTCTGCTTCAGG + Intronic
1112743209 13:102497773-102497795 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1113217730 13:108061653-108061675 AGAGAGAAACTGTTTGTTTGGGG + Intergenic
1113287989 13:108874670-108874692 ATGATGAAACTGTCTGCCTCTGG - Intronic
1114977234 14:28117096-28117118 AGAGAGACACTGTCTGCTTGGGG - Intergenic
1115282506 14:31679118-31679140 ACAGAGAATCTGTGTGCTTGGGG - Intronic
1116045604 14:39739675-39739697 AGAAAGAATCTGTGTGCTTTGGG + Intergenic
1116257007 14:42570149-42570171 AGACAGAATCTGTGTGCTTGGGG + Intergenic
1117420274 14:55537923-55537945 AAAGAGAAACTTTCTGATTGAGG - Intergenic
1117812328 14:59560892-59560914 TTAAAGATGCTGTCAGCTTGGGG - Intronic
1118431291 14:65720973-65720995 GCAAAGAATCTGTGTGCTTGGGG - Intronic
1119158860 14:72436430-72436452 ATAAACATACTGTCTGTTTTTGG - Intronic
1119268190 14:73277604-73277626 ATACAGAAACTAGCTGGTTGTGG + Intronic
1119448365 14:74685892-74685914 ATAAAGCAAGTGGCTGTTTGTGG - Intronic
1119887670 14:78156886-78156908 AGCCAGAAACTGTCTGCATGAGG + Intergenic
1120100001 14:80434450-80434472 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1120467845 14:84884516-84884538 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1120750314 14:88191277-88191299 AAAAAAAAACAGTCTGCTTAGGG + Intronic
1120955120 14:90075295-90075317 ATACAGAATCTTTCAGCTTGGGG + Intronic
1121212604 14:92220132-92220154 ATAAAAAAATTGTCTGGGTGTGG - Intergenic
1122453205 14:101828606-101828628 GTAAATAAACTTTCTGCTTTGGG + Intronic
1123134965 14:106019147-106019169 TTAAAGAGACTGACTTCTTGGGG - Intergenic
1124608930 15:31194212-31194234 AAAAAAAAACTCTCTGCTTAGGG + Intergenic
1126953083 15:53904141-53904163 ATAAGGAAACTCTTTGGTTGGGG + Intergenic
1126954527 15:53917677-53917699 ATAACTAAAATGTCTGCGTGTGG - Intergenic
1126990231 15:54366284-54366306 GTAAAGAAGCTGGCAGCTTGGGG + Intronic
1127123093 15:55787926-55787948 ATAAAGAAACTGGGTGTATGTGG + Intergenic
1127308354 15:57729558-57729580 ATAAGGATGCTGTGTGCTTGTGG - Intronic
1127585096 15:60370820-60370842 CTAAAGAAACTGTGTGGGTGGGG + Intronic
1127777435 15:62276904-62276926 CTAAAGAAACTGTCTCCTAATGG + Intergenic
1128490756 15:68140814-68140836 ATTAAGAAACTATCGGCTTCTGG - Intronic
1130180644 15:81624357-81624379 ATAAAAAAATTGTCTGGGTGTGG - Intergenic
1130717305 15:86347780-86347802 ACTAAGAAAATGTCTTCTTGGGG - Intronic
1130761898 15:86829749-86829771 ATAAAATAACTGTATGCTTTGGG - Intronic
1131687076 15:94779605-94779627 ATAAAGAAACTGTCAGCACAGGG + Intergenic
1132492564 16:241279-241301 AAAAAAAAGCTGTCTGCTTCAGG + Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133363654 16:5193914-5193936 AAAAAGGAACTGTCTCCTGGTGG - Intergenic
1133631405 16:7625475-7625497 ATACAGAAACTTCCTGCATGGGG + Intronic
1133671458 16:8025362-8025384 GTAAATAAACAGTCTGCATGTGG + Intergenic
1135183832 16:20297896-20297918 ATAAAGAAAATGTATGTTGGGGG + Intergenic
1135350811 16:21727410-21727432 AAAAAGAAACTGCCAGCTAGTGG - Intronic
1135393287 16:22111771-22111793 ATAAACAAACTGACTGGGTGTGG - Intronic
1139387671 16:66584322-66584344 ATAAAGATACTGGCTGGGTGTGG - Intronic
1142522605 17:515700-515722 ATAAATAAAGCTTCTGCTTGGGG + Exonic
1144673531 17:17146432-17146454 ACAAAGAAACTCTCTGGCTGTGG + Intronic
1144996902 17:19275950-19275972 GCAAAGAAACTGAATGCTTGAGG - Intronic
1145119308 17:20242417-20242439 ATGGAGACACTGTCTGCTTATGG + Intronic
1146149105 17:30451623-30451645 ATAAACAGACTTTCTGTTTGAGG + Intronic
1146277997 17:31527189-31527211 ATGGAGAAACAGTCTTCTTGTGG - Intronic
1148112171 17:45151231-45151253 ATAAAGCAAATGGCTGTTTGGGG + Exonic
1148477373 17:47937641-47937663 AAAAAAAAACGGTCTGCATGTGG - Intergenic
1149152983 17:53592210-53592232 ATATGGAAACTGTGTGCTTAGGG - Intergenic
1151711200 17:75807887-75807909 CTAAAGAAATTATCTGCTTCTGG - Intronic
1153209011 18:2738271-2738293 ATAAAGAGACTTTTTTCTTGGGG + Intronic
1154051189 18:10960611-10960633 ATAAATTAACTGTGTGTTTGAGG + Intronic
1154094192 18:11395385-11395407 AGACACAAACTGTCTCCTTGTGG + Intergenic
1156014481 18:32532644-32532666 AAAAAAAAACTCTCTCCTTGTGG - Intergenic
1156164627 18:34403373-34403395 AAAAAGTAAATGTCTGCCTGTGG + Intergenic
1158481419 18:57824719-57824741 AGAGAGAAACTGTGTGCTTGTGG - Intergenic
1159709993 18:71746315-71746337 ATAAACAAAATGTTTGTTTGAGG + Intronic
1159813234 18:73042204-73042226 ATTAAGAAAATGTCTCATTGTGG - Intergenic
1161331430 19:3689691-3689713 ATAATGGAACTGGCTGCTTCAGG + Intronic
1161431401 19:4234389-4234411 ATTGAGAAACTGTGTGCCTGGGG - Intronic
1161947362 19:7446011-7446033 ATAAAAAAACCTTCTGCTTCGGG - Intronic
1163020251 19:14477760-14477782 ATAAAGAATCTATCTGCTGTTGG - Exonic
1163372870 19:16911832-16911854 ATACAAAAACTGTCTGGGTGTGG - Intronic
1164485053 19:28648996-28649018 ATTAAGAATCTGTCTGTTTTGGG + Intergenic
1168562110 19:57393295-57393317 AGAAAGATACTGTCTAATTGGGG - Intronic
926036289 2:9638388-9638410 ATCAAGTAACTACCTGCTTGGGG - Intergenic
928293439 2:30060582-30060604 ATGGAGAATCTGTGTGCTTGGGG + Intergenic
928483951 2:31710968-31710990 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
928767852 2:34669979-34670001 AGACAGAAACTCTGTGCTTGAGG + Intergenic
928777714 2:34786807-34786829 GTAATGAAACTGTATGCTTATGG + Intergenic
929160384 2:38826235-38826257 ATAAAGAAACTGTGTAGTTTGGG - Intronic
929706124 2:44214029-44214051 ATAAAGAAACTGGTGCCTTGAGG - Intronic
929963947 2:46519621-46519643 ATGAAGAAACTGAGGGCTTGAGG - Exonic
930890951 2:56387217-56387239 ATCAAGAAACTGGATGTTTGAGG - Intergenic
933427291 2:82129239-82129261 ATAAAGAAAGTGACTTATTGGGG - Intergenic
934928857 2:98404021-98404043 AGAGAGAATCTGTGTGCTTGTGG + Intergenic
935307698 2:101753650-101753672 AAAAAAAAACTGTATACTTGCGG - Intronic
935560663 2:104556014-104556036 ATAAATAAATTGCCTGATTGTGG + Intergenic
936981627 2:118270204-118270226 ATGAAGAAACTGACTCCTAGAGG + Intergenic
938196718 2:129335021-129335043 ATAAAGAAACTGGCTTCTGGTGG + Intergenic
939996645 2:148926386-148926408 ACAAAGAAACTTTCTGTCTGCGG + Intronic
940251435 2:151681248-151681270 ATCAAGAAGCTGTCCGGTTGAGG + Intronic
940559963 2:155282298-155282320 ATGGAGAATCTGTATGCTTGGGG - Intergenic
942975870 2:182016197-182016219 AGAGAGAATCTGTGTGCTTGTGG - Intronic
943117693 2:183693428-183693450 AAAAAGTAACTGTATCCTTGGGG - Intergenic
945163266 2:206915178-206915200 ATAAAGATAATGTCTCCTTCTGG + Intergenic
945334319 2:208573467-208573489 AGAGAGAATCTGTGTGCTTGGGG + Intronic
945391314 2:209268377-209268399 ATAGAGAATGTGTCTGCTTATGG - Intergenic
945754574 2:213830312-213830334 ATAGAGAATCTGTGTGCTTTAGG - Intronic
945803851 2:214465955-214465977 AGAAAGAATCTGTGTGCTTGGGG - Intronic
1169242013 20:3990260-3990282 CCACAGAAACTTTCTGCTTGGGG + Intronic
1169738933 20:8868785-8868807 AAAAAAAAACTGGCTGCGTGTGG - Intronic
1173570680 20:44073850-44073872 AGCAAAAAACTGTCTGCTAGAGG + Intergenic
1174629968 20:51948164-51948186 ATAAAACAACTGTCTGGGTGCGG + Intergenic
1174679907 20:52396338-52396360 ATAAAGAAATAATCTGCTTCTGG + Intergenic
1174982258 20:55409042-55409064 AGATAGAACCTGTGTGCTTGGGG - Intergenic
1176152919 20:63602203-63602225 ATAACGACACTCTCAGCTTGAGG + Intronic
1177091470 21:16774403-16774425 AAAAAAAAAATGTCAGCTTGAGG + Intergenic
1177494702 21:21873532-21873554 AAAGAGAATCTGTGTGCTTGGGG - Intergenic
1177771188 21:25518541-25518563 AGAAAGAATCTGTGTGCTTGGGG + Intergenic
1178046361 21:28698502-28698524 AAAAAGAATCTCTCCGCTTGAGG - Intergenic
1179280770 21:39931973-39931995 TTAAAGAAACTGGCTACTTGAGG - Intergenic
1179728238 21:43352870-43352892 ATAAAGAAACTGCGTACATGCGG - Intergenic
1180097703 21:45566776-45566798 ATAAAGAAACTAAGTGTTTGAGG - Intergenic
1180732547 22:17993019-17993041 ACAAATAAACTTTCTGCTTTTGG - Intronic
1180755296 22:18156912-18156934 AGAGAGACACTGTTTGCTTGGGG - Intronic
1181517289 22:23422335-23422357 ACAAATAAACTTTCTGCTTTTGG - Intergenic
1181713250 22:24705003-24705025 ATAAACAAACTGTCTGGGAGAGG - Intergenic
1183992779 22:41609640-41609662 ATAAAAAAACTCTCTGGGTGTGG + Intronic
1184203204 22:42983332-42983354 AAAAAGAAACTGGCTGGGTGTGG + Intronic
1184510617 22:44931041-44931063 AGAAAGAAAATGACTCCTTGTGG - Intronic
1184527353 22:45032911-45032933 ATAAAAAAACTGGCTGGGTGTGG - Intergenic
1184978876 22:48081959-48081981 ATAAAGAAACACCGTGCTTGCGG - Intergenic
949523602 3:4880145-4880167 ATAATGAAACAGCCTACTTGAGG - Intronic
949623101 3:5838039-5838061 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
951437100 3:22677212-22677234 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
952683362 3:36121699-36121721 ATAAAGAATTTGTGTGCTTGAGG + Intergenic
953588000 3:44222487-44222509 ATGGAGCAACTGGCTGCTTGAGG - Intergenic
953739631 3:45526394-45526416 ATAAAGAAAGCCTGTGCTTGTGG + Intronic
955585336 3:60471536-60471558 AGAAAGAATCTTTGTGCTTGGGG - Intronic
956535008 3:70266147-70266169 ATAAAGCAACATTCTGCTTAAGG - Intergenic
958839399 3:99185902-99185924 AGAAAGAATCTGTGTGCTTGAGG + Intergenic
959111152 3:102123915-102123937 AGAAAGATACCCTCTGCTTGGGG - Intronic
960200886 3:114834904-114834926 ATAATGAAACTGTTTTCTTTGGG - Intronic
960354057 3:116629268-116629290 AGAGAGAATCTGTATGCTTGGGG - Intronic
960404025 3:117238038-117238060 AGAAAGAATCTGTGTGCTTGGGG + Intergenic
960475473 3:118119125-118119147 ACAAAGAAACTGTAGTCTTGAGG + Intergenic
960527210 3:118723622-118723644 ATGAAGGAATTGTCTGCTTGTGG - Intergenic
962038901 3:131683978-131684000 ATACAGAATCTGTGTGCTTGGGG - Intronic
962073620 3:132057431-132057453 ATAAATAAACTTGCTACTTGTGG - Intronic
962776988 3:138670651-138670673 TAGAATAAACTGTCTGCTTGAGG - Intronic
963061420 3:141230199-141230221 ATGAAGAGCCTGTCTGCTTCAGG - Intronic
963572033 3:147009401-147009423 AAAAAGAATCTGTGTGCTTGGGG - Intergenic
963701278 3:148629962-148629984 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
963917245 3:150870424-150870446 ATAAAAAGAATGTCTCCTTGTGG + Intergenic
965020208 3:163218875-163218897 AGAGAGAATCTGTGTGCTTGAGG - Intergenic
965182703 3:165425171-165425193 GTCAATAAAGTGTCTGCTTGAGG + Intergenic
965379138 3:167966751-167966773 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
965853937 3:173065674-173065696 AGAAAGAATCTGTGTGCTTGCGG + Intronic
966007913 3:175038975-175038997 ATAAACAAACTCTCTGATAGTGG + Intronic
966141825 3:176766275-176766297 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
966151561 3:176872789-176872811 AGAAAGAAACTGTGAGCCTGGGG + Intergenic
966551494 3:181209447-181209469 ATAAAGAAACTGTGACTTTGAGG + Intergenic
967840093 3:193998242-193998264 TTAAAGAACATGTGTGCTTGTGG - Intergenic
973217685 4:47688843-47688865 ATAAAAAAACTCTATGCTTATGG - Intronic
974224363 4:59019251-59019273 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
974266900 4:59597681-59597703 AGACAGAATCTGTGTGCTTGGGG + Intergenic
974645181 4:64680638-64680660 ATACAAAAACTGTCTGGGTGTGG - Intergenic
976049446 4:80994420-80994442 ATAAAGAAACTGAGTCCTGGAGG - Intergenic
977295916 4:95209025-95209047 ATAAAGACAATGTCTACTTCTGG + Intronic
977381122 4:96274874-96274896 ACAGAGAATCTGTGTGCTTGGGG - Intergenic
978258179 4:106718131-106718153 AGAAAGAATCTATGTGCTTGGGG + Intergenic
979316568 4:119272013-119272035 TTAAAGAAACAGTATGCTTCAGG + Exonic
979565192 4:122146485-122146507 AAAAAGAATCTGTATACTTGGGG - Intergenic
979945721 4:126829511-126829533 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
980440001 4:132830009-132830031 ATAAAGATAATGTCTCCTTCAGG - Intergenic
980596823 4:134965894-134965916 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
981069840 4:140523549-140523571 ATTAAGAAACTTACTGCTTGAGG + Intergenic
983391723 4:167140607-167140629 ATACACAATCTGTCTGGTTGTGG - Intronic
984343645 4:178491072-178491094 AGAGAGACACTGTCTTCTTGGGG + Intergenic
986885340 5:12226776-12226798 AGAGAGAATCTGTATGCTTGAGG - Intergenic
987430800 5:17830624-17830646 AAAAAGGAACTGTCTATTTGGGG + Intergenic
987769993 5:22289736-22289758 AGAGAGAAACGGTCTTCTTGGGG + Intronic
990213992 5:53510749-53510771 TTAAAGAATCTGTGTGCTTGGGG + Intergenic
990264039 5:54056672-54056694 ATAAAGAAACTGACACCTCGTGG + Intronic
991078552 5:62569208-62569230 AGACAGAAGCTGTGTGCTTGGGG - Intronic
991139255 5:63220137-63220159 ATAAAGAGATTGGCTACTTGTGG + Intergenic
992492758 5:77260915-77260937 ATAAAGAAACAGGGTACTTGGGG - Intronic
993270265 5:85787462-85787484 ATAAAGAGAATGTCTGTTTCTGG - Intergenic
993552610 5:89292791-89292813 ATAAATAAACTTTTGGCTTGAGG - Intergenic
994084087 5:95739705-95739727 ATAAAAAAACTGGCTGGGTGTGG - Intronic
995922756 5:117333111-117333133 AGAAAAAAATTGTTTGCTTGTGG - Intergenic
996553754 5:124756922-124756944 ATAAAGAAACTAGCTGGCTGTGG - Intergenic
997104506 5:131003900-131003922 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
997776122 5:136607117-136607139 AAAGGGATACTGTCTGCTTGGGG + Intergenic
999965015 5:156799944-156799966 AGAAAGAAACTGTCTCTTTTGGG + Intergenic
1001868913 5:175133262-175133284 AAAAAAAAAATCTCTGCTTGGGG - Intergenic
1002009881 5:176270645-176270667 AGAGAGAATCTGTGTGCTTGGGG + Intronic
1002216845 5:177641663-177641685 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
1003445454 6:6179672-6179694 ATTAAGAAACTATCCACTTGGGG + Intronic
1005289811 6:24368791-24368813 ATAATGACACTGTCTGATTGTGG + Intergenic
1005839864 6:29736659-29736681 ATCAAGAAAGTGTCTGCTCTAGG - Intronic
1006345760 6:33481135-33481157 ATAAAGAAAATGTGTGTGTGGGG - Intergenic
1007567284 6:42861841-42861863 ATAAAAAAATTGTCTGGGTGTGG + Intronic
1008023458 6:46606589-46606611 ATAAAGAAACTGAGTGATTTGGG + Intronic
1008765744 6:54912084-54912106 ATAACTTAACTGTCTGCTTGAGG + Intronic
1008848688 6:55997738-55997760 AGAAAGAATCTGTATGCTTAGGG - Intergenic
1009383751 6:63064194-63064216 ATATAGAATTTGTCTACTTGTGG - Intergenic
1009682254 6:66911228-66911250 AAAAAGAAATTATATGCTTGGGG + Intergenic
1009959920 6:70506776-70506798 AAAAATACCCTGTCTGCTTGCGG - Intronic
1011141739 6:84165206-84165228 AAAATGAAACTGTGTGCCTGGGG - Intronic
1011510824 6:88098965-88098987 AAAAAGAAAATGTCTGGTTTAGG - Intergenic
1011906923 6:92382106-92382128 ATAAAGATAGTGTCTTCTTCAGG - Intergenic
1012057117 6:94427176-94427198 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
1012827228 6:104162149-104162171 AGAAAGAAACTGTGTGCTTGGGG + Intergenic
1013545272 6:111150708-111150730 AAAGAGAATCTGTCTGATTGAGG - Intronic
1013629640 6:111973704-111973726 ATAAAGAAGCTCTCCTCTTGGGG - Intergenic
1014242935 6:119038236-119038258 CTAAAGAAACTGTAGGCTTGGGG + Intronic
1014494965 6:122110232-122110254 ATAAAAAATATGTGTGCTTGTGG - Intergenic
1014692326 6:124577376-124577398 AGCAAGAATCTGTGTGCTTGGGG + Intronic
1014794601 6:125710301-125710323 AGAGAGAATCTGACTGCTTGGGG + Intergenic
1015259560 6:131220631-131220653 ATAAATAAACTGTCTTTTTAAGG - Intronic
1016541373 6:145169944-145169966 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1017080933 6:150667842-150667864 GTAAAAATACTGTCTTCTTGTGG + Intronic
1017216700 6:151916478-151916500 AGAGAGAAATTCTCTGCTTGGGG + Intronic
1018598833 6:165516241-165516263 ATTAAGAGACTGTATGCTTATGG - Intronic
1018607462 6:165613288-165613310 ATCAAGAAATTGCCTGTTTGGGG + Intronic
1019193251 6:170266576-170266598 AAACAGAAAGTGTGTGCTTGTGG - Intergenic
1020145114 7:5636306-5636328 ATAAAGAAGGTGTCTTCTTTAGG - Intronic
1020212765 7:6168168-6168190 ATACAGAAAGTGTGTGCATGTGG - Intronic
1020574260 7:9905573-9905595 AAAAAAAAAATGTCTGCTGGCGG - Intergenic
1020574939 7:9914021-9914043 AGAGAGAATCTGTGTGCTTGAGG - Intergenic
1021506172 7:21387808-21387830 AAAAAGAAACTGCCTGGATGTGG + Intergenic
1021737158 7:23651037-23651059 ATAAAGAAAGTGGCTGGGTGTGG + Intergenic
1021864286 7:24939560-24939582 CTAAAGAAACTGGGTCCTTGAGG + Intronic
1021884989 7:25129460-25129482 ATAGAGAATCAGTGTGCTTGCGG - Intergenic
1022066056 7:26858790-26858812 ATAAAGTAACTCTCAGCTTCTGG + Intronic
1023240865 7:38146179-38146201 AGAGAGAATCTGTATGCTTGAGG + Intergenic
1023716134 7:43046279-43046301 AAACAGAATCTGTGTGCTTGGGG + Intergenic
1024336539 7:48212272-48212294 AGAAAGATTCTGTGTGCTTGAGG - Intronic
1024414582 7:49089750-49089772 ATAAAGAATCTCTCTGCTTAAGG + Intergenic
1025002018 7:55324096-55324118 AAAAAGAAACTGGCTGGGTGCGG - Intergenic
1027921282 7:84399102-84399124 AAAGAGAATCTGTGTGCTTGGGG + Intronic
1028299663 7:89181520-89181542 AGAAATAATCTGTGTGCTTGGGG - Intronic
1028353523 7:89879038-89879060 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
1029847844 7:103431298-103431320 AGAAAGAAAATGGCTGCTTCAGG - Intronic
1029851874 7:103469909-103469931 ATAAAGAAAATGTGAGCCTGGGG - Intergenic
1030761803 7:113361217-113361239 GTAAAGAATCTTTCAGCTTGAGG - Intergenic
1030775733 7:113531798-113531820 ATAAAGAATCTGTGAACTTGAGG + Intergenic
1030990222 7:116290825-116290847 AGAGAGAATCTGTATGCTTGAGG + Intronic
1031565833 7:123296149-123296171 AGAGAGAATCTGTATGCTTGGGG + Intergenic
1031728362 7:125265291-125265313 TCAAAGAAACTGTCTGCTTAAGG - Intergenic
1031795703 7:126172333-126172355 AAAAAAAAACTCTCTTCTTGGGG + Intergenic
1032752229 7:134852858-134852880 ACAAATAAAAGGTCTGCTTGTGG + Intronic
1032950392 7:136902554-136902576 AGAAAGAAAGTGGCTGCTTATGG - Intronic
1033357000 7:140607999-140608021 ATAGGGAAACTGTTTTCTTGAGG - Intronic
1033502577 7:141966507-141966529 ATAGAGTATCTGTGTGCTTGAGG - Intronic
1033979575 7:147147377-147147399 AAAAAGAAACTGTTTGCATTAGG - Intronic
1034396405 7:150828817-150828839 ATAAGGGAACTATCTGATTGTGG - Intronic
1034585339 7:152086342-152086364 ATAAAGGAACTATCTGTTTTCGG - Intronic
1035598331 8:879335-879357 GAAATGACACTGTCTGCTTGGGG + Intergenic
1035885118 8:3283282-3283304 ATAAAGAAAGTGTCAGACTGGGG + Intronic
1036074876 8:5485862-5485884 AGAAATACACTGTCTTCTTGAGG + Intergenic
1039558075 8:38491089-38491111 ATGAAGAAACTGGCTGGGTGTGG - Intergenic
1039974568 8:42350807-42350829 AAAATGAAAATGACTGCTTGGGG + Intronic
1040466523 8:47700611-47700633 ACAAAGGAACTGACTGCATGGGG - Intronic
1041606821 8:59792011-59792033 AGAGAGAATCTGTCTGCTTGGGG + Intergenic
1041909162 8:63069577-63069599 ATAAAAAAACTGGCTGAGTGTGG + Intronic
1042074113 8:64969119-64969141 ATAAAGAAATTGTCTTATTTTGG - Intergenic
1042432427 8:68724074-68724096 ATCTAGAAATTGTCTGCTTCAGG - Intronic
1044054535 8:87552247-87552269 ATGAAGAAACTTTCTTGTTGAGG + Intronic
1045171608 8:99676534-99676556 AGAGAGACACCGTCTGCTTGGGG - Intronic
1048161013 8:132022109-132022131 ATAAAGATAATGTCTCCTTCTGG + Intergenic
1050658701 9:7858802-7858824 ATAAAGAAACAGTGTGATTAGGG + Intronic
1051469709 9:17423832-17423854 AGAGAGAATCTGTGTGCTTGGGG - Intronic
1051974924 9:22937880-22937902 GTAAAGAGGCTGTCTGCATGTGG - Intergenic
1052477557 9:28980018-28980040 ATCAAGACATTGTTTGCTTGTGG - Intergenic
1054982459 9:71222733-71222755 AAAGAGAATCTGTGTGCTTGGGG + Intronic
1057097708 9:92326937-92326959 CTACAGAAAATGTCTGCGTGCGG + Intronic
1058768580 9:108207867-108207889 GTAAACAAACTGCCAGCTTGTGG - Intergenic
1058830856 9:108815159-108815181 ATAAAGACCCTGTCTTTTTGAGG - Intergenic
1058830910 9:108815486-108815508 ATAAAGACACTGTCTTTTTGAGG + Intergenic
1059723271 9:116982515-116982537 ATAAAGAAACTGTGGTCTTTTGG - Intronic
1061229198 9:129303726-129303748 AGAAAGAAATTGTGTGCTCGTGG + Intergenic
1061311672 9:129767681-129767703 ATACAGAAACTGCGTGCCTGTGG - Intergenic
1061588112 9:131581396-131581418 ACAAAGAAACTGGCTGGGTGTGG + Intronic
1062545340 9:137060460-137060482 ATAAAAAAATTGTCTGTGTGTGG - Intergenic
1186400083 X:9249936-9249958 ATAACGAGAGTGTGTGCTTGTGG - Intergenic
1187423885 X:19160202-19160224 AGAAAGAACCTGTCTGACTGGGG + Intergenic
1187575130 X:20546019-20546041 AGAGAGAATCTGTCTGCTTGGGG - Intergenic
1188228546 X:27632106-27632128 AGGGAGAAACTTTCTGCTTGAGG - Intronic
1188393100 X:29645429-29645451 AAAGAGATTCTGTCTGCTTGGGG + Intronic
1188636644 X:32440859-32440881 ATAAACAAACTCACTGCTTTAGG - Intronic
1188779717 X:34266698-34266720 ATAAAGACACTGTCTCATTCAGG + Intergenic
1188973269 X:36642578-36642600 AAAAAGAATCTGTGTGCTTTGGG - Intergenic
1189012142 X:37056527-37056549 ATTAAGCAACTGTCTGGGTGAGG + Intergenic
1189036567 X:37499756-37499778 ATTAAGCAACTGTCTGGGTGAGG - Intronic
1189875799 X:45434532-45434554 AGAAAGAATCTGTGTACTTGGGG - Intergenic
1190082552 X:47367914-47367936 AGAGAGAAACTATCTGCTTTTGG + Intergenic
1190122601 X:47674573-47674595 AGAGAGAATCTGTGTGCTTGAGG - Intergenic
1190501492 X:51083056-51083078 ATCAAGAAAATGTCTGATTTTGG + Intergenic
1193170057 X:78325341-78325363 ATAACAAAACTGACTGCATGGGG - Intronic
1193335578 X:80285011-80285033 AGAGAGAATCTGTCTGCTTGGGG + Intergenic
1193750519 X:85337295-85337317 AGAGAGAATCTGTGTGCTTGAGG - Intronic
1193800468 X:85929522-85929544 AAACAGAAACTCTCTGGTTGTGG - Intronic
1194398087 X:93411428-93411450 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1195136018 X:101907557-101907579 ACTAAGAAACTGTGTTCTTGTGG - Intronic
1195484362 X:105386726-105386748 ATAAATATACTGTCTTGTTGTGG + Intronic
1195825047 X:108990568-108990590 AAAGAGAATCTGTGTGCTTGAGG - Intergenic
1196290130 X:113930094-113930116 ATAGAGAATCTGTATGCTTGGGG - Intergenic
1196504267 X:116422733-116422755 AGCAGGAAACTGCCTGCTTGAGG + Intergenic
1197399866 X:125977332-125977354 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1197487858 X:127075485-127075507 AGAAAGAATCTGTGTGCTTGGGG - Intergenic
1197876788 X:131117156-131117178 ATAAGGAAACTTTCTTTTTGGGG - Intergenic
1198395263 X:136213364-136213386 ATCAAGAACCTCTCTGCTTGTGG + Intronic
1198412540 X:136386140-136386162 CTCCAGAAACTGTCTGCTTTTGG + Intronic
1198608140 X:138367280-138367302 ATAGAGAAAATATCTGCTTCAGG + Intergenic
1199188941 X:144948819-144948841 AGAAAGAATTTGTATGCTTGGGG + Intergenic
1200166167 X:154036774-154036796 GAAAATGAACTGTCTGCTTGGGG + Intronic
1200386120 X:155892670-155892692 ATAAAAAGAGTGTCTGATTGCGG - Intronic
1200969896 Y:9140608-9140630 ATAAAGAACCTAACTGCTTTAGG - Intergenic
1201546268 Y:15165365-15165387 ATACAAAAACTAGCTGCTTGTGG + Intergenic
1202141103 Y:21723644-21723666 ATAAAGAACCTAACTGCTTTAGG + Intergenic
1202145762 Y:21780155-21780177 ATAAAGAACCTAACTGCTTTAGG - Intergenic