ID: 1070556602

View in Genome Browser
Species Human (GRCh38)
Location 10:77532661-77532683
Sequence GTTTCCATGGGGGAAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070556593_1070556602 23 Left 1070556593 10:77532615-77532637 CCATGTACTGAATATTTTTAAAG No data
Right 1070556602 10:77532661-77532683 GTTTCCATGGGGGAAGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070556602 Original CRISPR GTTTCCATGGGGGAAGAGGG TGG Intronic
No off target data available for this crispr