ID: 1070557410

View in Genome Browser
Species Human (GRCh38)
Location 10:77539303-77539325
Sequence GATAATGCAGAGATGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070557406_1070557410 0 Left 1070557406 10:77539280-77539302 CCTAAGTCAGGTTGCTTGTCCAA 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1070557410 10:77539303-77539325 GATAATGCAGAGATGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070557410 Original CRISPR GATAATGCAGAGATGGAGAT GGG Intronic
No off target data available for this crispr