ID: 1070558428

View in Genome Browser
Species Human (GRCh38)
Location 10:77547527-77547549
Sequence CACACAGAGGTGGGCCCGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070558428_1070558434 3 Left 1070558428 10:77547527-77547549 CCAACCGGGCCCACCTCTGTGTG 0: 1
1: 0
2: 1
3: 14
4: 156
Right 1070558434 10:77547553-77547575 TCTCCAGATCAACAGAAATTTGG No data
1070558428_1070558436 5 Left 1070558428 10:77547527-77547549 CCAACCGGGCCCACCTCTGTGTG 0: 1
1: 0
2: 1
3: 14
4: 156
Right 1070558436 10:77547555-77547577 TCCAGATCAACAGAAATTTGGGG No data
1070558428_1070558435 4 Left 1070558428 10:77547527-77547549 CCAACCGGGCCCACCTCTGTGTG 0: 1
1: 0
2: 1
3: 14
4: 156
Right 1070558435 10:77547554-77547576 CTCCAGATCAACAGAAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070558428 Original CRISPR CACACAGAGGTGGGCCCGGT TGG (reversed) Intronic
900493688 1:2966426-2966448 GACAGAGAGGTGGGCCCAGCTGG - Intergenic
903350804 1:22715447-22715469 GCCCCAGAGGTGGGCCCAGTAGG - Intronic
905267000 1:36761195-36761217 CACACAGAGGAGGGACAGGAAGG + Intergenic
906650714 1:47510596-47510618 CTCCCAGAGTTGGGCCTGGTGGG - Intergenic
919447884 1:197732288-197732310 AACACATAGGTGGGCCAGTTAGG - Intronic
922533761 1:226364678-226364700 CACTCAGAGGTGGCCCGGCTGGG + Intronic
923366495 1:233266936-233266958 CAGACAGAGGTGGGTCCAATGGG - Intronic
1069905295 10:71728695-71728717 CAAACAGAGCTGGGGCCGGTAGG - Intronic
1070558428 10:77547527-77547549 CACACAGAGGTGGGCCCGGTTGG - Intronic
1072660611 10:97361390-97361412 CAAACAGAGGTGGCCCCAGCTGG + Intronic
1074446759 10:113527099-113527121 CATACAGAGTTGGGCCCTGGTGG + Intergenic
1075883240 10:125873011-125873033 CACACAGAGGTTGGGCTGCTGGG + Intronic
1081035310 11:38136911-38136933 GAGACAGAGGTGGGCCCTCTGGG - Intergenic
1083174658 11:60942065-60942087 CACAGAGATGTTGGCCGGGTTGG + Exonic
1084004667 11:66316632-66316654 CACACAGCGCTGGGCCGGGCAGG + Exonic
1085706290 11:78789248-78789270 AACAGACAGGTGGGCCTGGTTGG - Intronic
1088181728 11:107120920-107120942 CCCACAGTGGTGGGCCCAGCTGG - Intergenic
1089679217 11:120110090-120110112 CCCACAGAGGTGGACCTGCTGGG + Intergenic
1089698918 11:120232446-120232468 CACACAGAGCTGGGCCCCAGCGG - Intergenic
1090972551 11:131655769-131655791 CACACAGAGCTTGGCTGGGTAGG - Intronic
1091193136 11:133710950-133710972 CACAGAGGGGAGGGCCTGGTAGG - Intergenic
1095756319 12:45770744-45770766 CACTCAGAGGTGGGCACAGCAGG + Intronic
1096071359 12:48777136-48777158 CACACAGCAGTGGGCATGGTCGG + Exonic
1102164354 12:110794817-110794839 AACACATAGGTGGGCTGGGTGGG + Intergenic
1103716259 12:122947155-122947177 CACACAGAGGTGGGGGCTGAGGG + Intronic
1103949285 12:124542429-124542451 CCCACAGAGATGGGCGAGGTGGG + Intronic
1104710132 12:130979872-130979894 CACACAAAGAAGGGCCAGGTGGG + Intronic
1104975190 12:132549028-132549050 CTCACAGCTGAGGGCCCGGTGGG + Intronic
1113992945 14:16042584-16042606 CACACAGGGGTGGCTCCGGAAGG - Intergenic
1114482816 14:23046019-23046041 CACACACAGGTAGGCGAGGTAGG - Intergenic
1114657048 14:24322581-24322603 CACTCATAGGTGGGCCCTGGTGG + Intronic
1115392223 14:32866396-32866418 CACACAGAAGTGGGACTGCTGGG + Intergenic
1115521708 14:34239499-34239521 CACACAGGGGTGGGCTTAGTGGG - Intronic
1117813980 14:59578197-59578219 CACACAGAGGAGGGCCCAGAAGG - Intergenic
1121280511 14:92694125-92694147 TACACAGAGGTGGACCCGGGTGG - Intergenic
1123465207 15:20509977-20509999 CACACAGGGCCAGGCCCGGTGGG - Intergenic
1123652909 15:22491052-22491074 CACACAGGGCCAGGCCCGGTGGG + Intergenic
1123743330 15:23299915-23299937 CACACAGGGCCAGGCCCGGTGGG + Intergenic
1124275934 15:28325956-28325978 CACACAGGGCCAGGCCCGGTGGG - Intergenic
1124292198 15:28463495-28463517 CACACAGGGCCAGGCCCGGTGGG + Intergenic
1124306766 15:28585645-28585667 CACACAGGGCCAGGCCCGGTGGG + Intergenic
1129262623 15:74377240-74377262 CACAGAGAGCTGGGCCTGGAGGG - Intergenic
1129457315 15:75682829-75682851 CACACAGAGGTGGGTGCTGAGGG - Exonic
1129726471 15:77904116-77904138 CACACAGAGGTGGGTGCTGAGGG + Intergenic
1130274513 15:82469464-82469486 CACACAGAGGTGGGTGCTGAGGG + Intergenic
1130466861 15:84196838-84196860 CACACAGAGGTGGGTGCTGAGGG + Intergenic
1130497403 15:84476698-84476720 CACACAGAGGTGGGTGCTGAGGG - Intergenic
1130589155 15:85201431-85201453 CACACAGAGGTGGGTGCTGAGGG + Intergenic
1132385948 15:101399846-101399868 CACACAGAGCTGGGCCCCGTGGG - Intronic
1132389045 15:101425350-101425372 CACCCAGAGGTGGGCTTGGAGGG - Intronic
1132584053 16:698460-698482 CCCAGAGGGGTGGGCCTGGTGGG - Intronic
1132655018 16:1038178-1038200 CACACAGAGGAGAGGCCTGTGGG - Intergenic
1133206992 16:4239870-4239892 CCCAAAGAGGAGGGCCCAGTGGG + Intronic
1137718901 16:50615865-50615887 CAAACAGAGGTGGGATCGCTAGG + Intronic
1138655342 16:58488109-58488131 CACAGAGAGGTGAACCCAGTTGG + Intronic
1138778572 16:59755080-59755102 AACAGAGAGGTGGCCCCGGTAGG + Intergenic
1141400820 16:83745371-83745393 CACACAGAGGCGGTCTGGGTTGG - Intronic
1141767824 16:86070374-86070396 CACATAGAGGTGGCCCTTGTGGG - Intergenic
1141895002 16:86953713-86953735 CACACAGGGCTGGCCCCTGTCGG - Intergenic
1143233937 17:5381773-5381795 AATACAGGGGTGGGCCTGGTTGG - Intronic
1144699192 17:17325728-17325750 CACAGAGAGGGGGGCACAGTGGG - Intronic
1144758512 17:17694433-17694455 CTCTGAGAGGTGGGCCAGGTTGG - Intronic
1147418433 17:40309922-40309944 CACACACAGGTGGGGTCGGGGGG - Intronic
1148630705 17:49106180-49106202 CACACAGAGCTGGGCACAGTTGG + Intergenic
1150270703 17:63862641-63862663 GACTCAGAAGTGGGCCTGGTGGG + Intergenic
1150274332 17:63886162-63886184 GACTCAGAAGTGGGCCTGGTGGG + Intergenic
1150276476 17:63900990-63901012 GACTCAGAAGTGGGCCTGGTGGG + Intergenic
1152081485 17:78190247-78190269 CACACAGAGGTGAGGCTGGGAGG - Intronic
1154287596 18:13074662-13074684 CTCACAGAGGTGGGCTGGATGGG + Intronic
1157003958 18:43559731-43559753 CACACAGAAGTGGGGCCACTGGG + Intergenic
1157402715 18:47401191-47401213 CACAGTGCGGTGGCCCCGGTGGG - Intergenic
1157403007 18:47402317-47402339 CACAGTGCGGTGGCCCCGGTGGG - Intergenic
1157403139 18:47402820-47402842 CACAGTGCGGTGGCCCCGGTGGG - Intergenic
1157403171 18:47402944-47402966 CACAGTGCGGTGGCCCCGGTGGG - Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160506894 18:79432364-79432386 CACACGGAGGTGAGGACGGTCGG + Intronic
1160789800 19:918161-918183 CACACAGCTGTGAGCCCAGTCGG + Intronic
1161316382 19:3619469-3619491 GACCCGGAGGTGGGCCAGGTGGG + Intronic
1162562741 19:11426868-11426890 CACACGGAGGTGGCCAAGGTAGG - Exonic
1163796209 19:19339510-19339532 CACACAGCGTTGGGGCCAGTGGG - Intronic
1165308982 19:35019301-35019323 GAGACACAGGTGGGCCAGGTGGG + Exonic
1165831121 19:38730951-38730973 CACAGACAGGTGAGCCAGGTGGG - Exonic
1166331724 19:42081610-42081632 CACCCAGAAGTGGGCCTGGCAGG + Intergenic
1167439591 19:49500610-49500632 CACACAGAGGTGGGGACGACAGG + Intergenic
1168287233 19:55340847-55340869 CGCACAGCGGTGGGCACGGCAGG - Intronic
1168548147 19:57271001-57271023 GATACAGAGCTGGGCCTGGTGGG - Intergenic
925204312 2:1993281-1993303 CACACAGGGGTCCGCCAGGTGGG + Intronic
926243226 2:11103727-11103749 CCCGCAGAGGTGAGCCCGGCTGG + Intergenic
926745469 2:16153374-16153396 CACACAGAAGTGGCCCAGGTAGG - Intergenic
932419654 2:71594035-71594057 GTCACAGTGGTGGGCCAGGTAGG + Intronic
934059719 2:88282989-88283011 CAGAATGAGGTGGGCCAGGTAGG - Intergenic
934979303 2:98826933-98826955 CACACAGAGGCAGGCCAGGCAGG - Intronic
937106150 2:119315205-119315227 CACACAGAGGAGGCTCGGGTGGG + Intronic
937363044 2:121242345-121242367 CTCACAGAGGTGAGCCGGCTGGG - Exonic
941739248 2:169015506-169015528 CACCCAGAGGTGGGAACAGTTGG - Intronic
946516021 2:220412384-220412406 CACACAGAAGTGGGGCTGCTGGG + Intergenic
948425726 2:237885713-237885735 CACACAGAGAGGGGCACGGCAGG - Intronic
948431645 2:237922781-237922803 CACACAGAGGGTGGCCCACTGGG - Intergenic
1168960276 20:1864305-1864327 CACACACAGCTGGGACAGGTGGG + Intergenic
1171457679 20:25281130-25281152 CAGACAGAGCTGGCCCCGCTCGG - Intronic
1172620052 20:36312823-36312845 CAGACAGAGGTGGGTCCGGGAGG + Intronic
1173362127 20:42354218-42354240 CACACAGAGGTGATCCCTGATGG - Intronic
1173649159 20:44651888-44651910 CGCCCACAGGTGGGTCCGGTCGG - Intronic
1175766200 20:61594402-61594424 CAGACCCAGGTGGGCCCGGTGGG - Intronic
1181047348 22:20221873-20221895 CAAAGAGAGGTGGGCCTGGTGGG + Intergenic
1182068593 22:27447403-27447425 GAGACAGAGGTGGGCGTGGTGGG + Intergenic
1182681311 22:32082206-32082228 CATGCAGAGCTGGGCCCTGTGGG + Intronic
1183612889 22:38922575-38922597 CCCACACTGGTGGGCCCCGTAGG + Intergenic
1183669211 22:39262501-39262523 CAGAGAGAGGTGGGGCGGGTGGG - Intergenic
1184818755 22:46892986-46893008 CAGGCAGAGCTGGGCCCGGTGGG + Intronic
952007887 3:28863324-28863346 CACAGAGAGGTTGGCATGGTGGG - Intergenic
953080056 3:39608517-39608539 CACACAGAAGTGGGGCCACTGGG + Intergenic
953080138 3:39608945-39608967 CACACAGAGATGGGGCTGCTGGG + Intergenic
953487847 3:43319098-43319120 CTCACTGAGATGGGCCAGGTGGG + Intronic
960015641 3:112885048-112885070 CACACAGAGGCTGGTCGGGTTGG + Intergenic
961427360 3:126858590-126858612 CAAACACAGGTGGGCCTGGGAGG - Intronic
962473179 3:135731768-135731790 CACACAGAGGTGGGGTCGCTAGG + Intergenic
963729029 3:148953246-148953268 CAAACAGAGGTGGGCCCTGGTGG - Intergenic
968400326 4:289841-289863 CTCATGGAGGTGGGCCTGGTGGG - Intronic
968636729 4:1684643-1684665 CGCAGCGAGGAGGGCCCGGTCGG + Intergenic
969614754 4:8245883-8245905 CACAGAGAGGCCGGCCCAGTAGG + Intergenic
975281704 4:72569247-72569269 CACGCAGAGGTGGGGGCGGGAGG + Intergenic
980539691 4:134177472-134177494 CACACAGAAGTGGGACTGCTGGG - Intergenic
982197410 4:152930166-152930188 CACACAGTGGTGGGGTAGGTAGG + Intergenic
986256533 5:6105559-6105581 CAGGCAGAGGTGGGCCCAGCTGG - Intergenic
986654689 5:9999597-9999619 CACACAGAAGTGGGACCACTGGG - Intergenic
986897220 5:12385052-12385074 CACACAGAAGTGGGACTGCTGGG + Intergenic
987583467 5:19824704-19824726 CACACAGAAGTGGGACTGCTGGG - Intronic
988675421 5:33428221-33428243 CACACAGAAGTGGGACCACTGGG + Intergenic
996306510 5:122053617-122053639 CACACAGAAGTGGGGCCGCTGGG + Intronic
997729942 5:136162298-136162320 CACACAGACGTGGCCCTGGCTGG + Intronic
999998498 5:157115210-157115232 CACACAGATGTGTGCTCTGTGGG - Intronic
1001251064 5:170147331-170147353 GACACAGAGGGGAGCCGGGTGGG - Intergenic
1002044028 5:176532200-176532222 CACAGAGAGGAGGCCCCGATAGG + Intronic
1002077520 5:176717765-176717787 CAAGCTGAGGTGGGCACGGTCGG + Intergenic
1002079105 5:176727235-176727257 CACACAGAGGTGGGGCAGACAGG + Intergenic
1002914816 6:1520373-1520395 CACACAGAGATGGGACTGGAAGG - Intergenic
1003039739 6:2676728-2676750 GATGCAGAGGTGGGCCCAGTGGG - Intronic
1004155557 6:13164526-13164548 CAAACAGAGGTGGGGCCTGGAGG - Intronic
1005913356 6:30329718-30329740 CACAACGGTGTGGGCCCGGTGGG - Exonic
1006829355 6:36959360-36959382 CACGCAGGTGTGGGCCCGGCGGG + Exonic
1017606870 6:156144289-156144311 AACACAGAGGGGTGACCGGTTGG + Intergenic
1019435244 7:1019265-1019287 CAACCACAGGTGGGCCTGGTTGG - Intronic
1019852454 7:3573322-3573344 TACGCAGAGGCGGGGCCGGTGGG + Intronic
1021960091 7:25862316-25862338 CACACAGAGGTGGGGCGAGAGGG + Intergenic
1022468271 7:30665704-30665726 GACACAGAGGTGGCCACGGCTGG - Intronic
1024048281 7:45600109-45600131 AGCACAGAGGTGGGCCCTGGTGG - Intronic
1029807186 7:103009969-103009991 CACACAGAAGTGGGGCTGCTGGG - Intronic
1032584309 7:133132260-133132282 CACATCGAGGTGGGCCAGGGAGG - Intergenic
1035114118 7:156508245-156508267 CACTCACAGGTGAGCTCGGTTGG + Intergenic
1040933932 8:52764110-52764132 GACACAGTGGTTGGCCTGGTAGG - Intergenic
1041495972 8:58485733-58485755 CACAGAGAGGTGAGCCCCATTGG - Intergenic
1041532139 8:58881037-58881059 CACACAGGGGAGGCCCCTGTGGG - Intronic
1045803138 8:106124617-106124639 CACTCAGAAGTGTGCCTGGTAGG + Intergenic
1046561006 8:115837321-115837343 CACACAGAGGAGGACCCTATTGG + Intergenic
1047356796 8:124129655-124129677 CACACAGAAGTGGGACCACTGGG - Intergenic
1052598150 9:30588616-30588638 CACACAGAGCTGAGCACGTTGGG - Intergenic
1053002590 9:34585576-34585598 AGCACAGAGCTGTGCCCGGTTGG - Intronic
1055815618 9:80201753-80201775 CACACAGAGGTAGGGACAGTTGG - Intergenic
1056565713 9:87771053-87771075 CACAGAAAGGTGGGGCCGGGTGG - Intergenic
1057772217 9:97978788-97978810 CCCACAGAGGGGTGCCTGGTTGG + Intergenic
1060475782 9:123985494-123985516 CACACAGAGGTGCCCCAAGTAGG - Intergenic
1061482606 9:130904337-130904359 CACACAGGTGTGGGCACGGGGGG + Intronic
1061889509 9:133610211-133610233 CACTCAGAGCTGTGCCTGGTGGG + Intergenic
1062414875 9:136443267-136443289 CACGCAGAGCTGAGCACGGTGGG + Intronic
1062532458 9:137007905-137007927 CACCCAGAGCTGGGCCAGGGAGG - Exonic
1185631279 X:1517434-1517456 CACACAGAGGCGGACAAGGTTGG - Intronic
1188115064 X:26232498-26232520 CACACTGAGGTGGTCTCGGACGG - Intergenic
1189717014 X:43877401-43877423 GACACAGTGTTGGGGCCGGTTGG - Intronic
1190301450 X:49059732-49059754 CACCCAGAGGCGGGCCCGGCAGG - Intronic
1191762886 X:64663652-64663674 CACACAGAAGTGGGGCTGCTGGG - Intergenic
1194067710 X:89283518-89283540 CACACAGGTGTGGGACCTGTGGG + Intergenic