ID: 1070559240

View in Genome Browser
Species Human (GRCh38)
Location 10:77553451-77553473
Sequence GGTGCTCACTGCTGACCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070559240_1070559245 12 Left 1070559240 10:77553451-77553473 CCACTGGGTCAGCAGTGAGCACC No data
Right 1070559245 10:77553486-77553508 GCCCTCGCCTCCCTCCTGCTGGG No data
1070559240_1070559251 23 Left 1070559240 10:77553451-77553473 CCACTGGGTCAGCAGTGAGCACC No data
Right 1070559251 10:77553497-77553519 CCTCCTGCTGGGCAGTCACCAGG No data
1070559240_1070559244 11 Left 1070559240 10:77553451-77553473 CCACTGGGTCAGCAGTGAGCACC No data
Right 1070559244 10:77553485-77553507 TGCCCTCGCCTCCCTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070559240 Original CRISPR GGTGCTCACTGCTGACCCAG TGG (reversed) Intronic