ID: 1070559529

View in Genome Browser
Species Human (GRCh38)
Location 10:77555356-77555378
Sequence CCCCATGAGGTCTTCAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 19, 3: 80, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070559529_1070559532 0 Left 1070559529 10:77555356-77555378 CCAGGACTGAAGACCTCATGGGG 0: 1
1: 0
2: 19
3: 80
4: 219
Right 1070559532 10:77555379-77555401 CAGAAAGAAAAAAAACAGAAAGG No data
1070559529_1070559533 10 Left 1070559529 10:77555356-77555378 CCAGGACTGAAGACCTCATGGGG 0: 1
1: 0
2: 19
3: 80
4: 219
Right 1070559533 10:77555389-77555411 AAAAACAGAAAGGTAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070559529 Original CRISPR CCCCATGAGGTCTTCAGTCC TGG (reversed) Intronic
901903878 1:12391364-12391386 CCCCATGAAGCCATCAGTGCAGG + Intronic
903646049 1:24897093-24897115 CCCCATGAGGGCTCCAGAGCTGG - Intergenic
904486670 1:30829311-30829333 TCCCATGAGGTCTGCAGTCAGGG + Intergenic
905168419 1:36097014-36097036 CACCATGGGGGCTGCAGTCCTGG + Exonic
905773862 1:40655355-40655377 CCCCAGGAGGTCTCAAGTCCTGG + Intronic
906050530 1:42867728-42867750 CCCCATGAGGCCATCAGTGCAGG - Intergenic
907520302 1:55019510-55019532 CCCCACGAGGTCCCCAGGCCTGG - Intergenic
907780384 1:57561148-57561170 CCCCATGAGTTCATCGGTGCAGG - Intronic
908737430 1:67291127-67291149 CCCCATGAGGCCATCAGTGCAGG - Intergenic
909032843 1:70561993-70562015 CCCCATGAGGCCATGAGTGCAGG + Intergenic
909675997 1:78239659-78239681 CCCCAAATGGTCTTCAGCCCAGG + Intergenic
910561940 1:88600294-88600316 CCCCATGAGGCCATCAATGCAGG - Intergenic
910588252 1:88902036-88902058 CCCCATGAGGCCATCGGTGCAGG - Intergenic
910948255 1:92617022-92617044 CCCCATGAGGCCATCAGTGCGGG - Intronic
914965465 1:152253592-152253614 CCCCATGAGGCCATCAGTGCAGG + Intergenic
916000286 1:160608576-160608598 CCCAGTGAGGTCTTGAGCCCAGG + Exonic
916841652 1:168607754-168607776 TCCCAGGATGTCTTAAGTCCTGG - Intergenic
917764569 1:178202323-178202345 CCCCATGAGGCCATCAGTGCAGG - Intronic
919124579 1:193379468-193379490 CCTCATGAGGCCATCAGTGCAGG + Intergenic
920197477 1:204238680-204238702 CCCCATGAGTCCATCAGTGCAGG - Intronic
920500946 1:206485150-206485172 CCCCGTGGGGTCTTCAGCCTGGG - Intronic
921031446 1:211338389-211338411 CCCCAGGAAGTTTTCAGTCAAGG - Intronic
923046942 1:230362469-230362491 CCCCAGGAGGGCTTCCTTCCAGG - Intronic
1063225880 10:4014041-4014063 CACCATCACGTCTTCAGTTCTGG - Intergenic
1063369468 10:5511779-5511801 CACCCTGAGGTCCTCAGGCCAGG + Intergenic
1066957661 10:42188367-42188389 CCCCATGAGGTCATCAGTGCTGG - Intergenic
1067125510 10:43512230-43512252 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1067333177 10:45340531-45340553 CCCCATGAGGCCATCGGTGCAGG - Intergenic
1069145795 10:64890749-64890771 CCCCATGAGGTGATTAGTGCAGG - Intergenic
1069790788 10:71019270-71019292 CCCCATGAGGCTATCAGTGCAGG + Intergenic
1070559529 10:77555356-77555378 CCCCATGAGGTCTTCAGTCCTGG - Intronic
1071267039 10:83973692-83973714 CCCCATGAAGCCGTCAGTGCAGG + Intergenic
1072360507 10:94654462-94654484 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1073822869 10:107285240-107285262 TCCCATGAGGACTTCAGCACAGG - Intergenic
1073918439 10:108432001-108432023 CCCCATGAGGCCATCAGTGCAGG + Intergenic
1074500369 10:114018093-114018115 CCCCATGAGCTCCTCAGGACAGG + Intergenic
1076200648 10:128555011-128555033 CCCCAAGTGGTCTTCTCTCCTGG - Intergenic
1078354847 11:10625896-10625918 AGCCCTGAGGTCTTCAGCCCAGG + Intronic
1078397171 11:10991537-10991559 CCCCAGGAGGTCCTCTGTCTAGG + Intergenic
1079154163 11:17928739-17928761 CCCCTTGGGGTCTTCTGTTCTGG - Intronic
1080918686 11:36686972-36686994 CTCAATGTGGTCTGCAGTCCTGG + Intergenic
1081110513 11:39128699-39128721 CCCCACGAGGCCATCAGTGCAGG - Intergenic
1081378330 11:42386231-42386253 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1081607811 11:44538143-44538165 CTCCATGTGTTCTTCACTCCTGG + Intergenic
1081609097 11:44548166-44548188 CCCCATGAGGCCATCAGTTCAGG - Intergenic
1083093183 11:60221414-60221436 CCCCATGAGACCATCAGTGCAGG - Intronic
1083889750 11:65589868-65589890 CCCCAGGAAGTCCCCAGTCCAGG - Intronic
1085685998 11:78622478-78622500 CCCCATGAGGCCATCTGTGCAGG - Intergenic
1085705843 11:78786330-78786352 CCCCAAGAGGTCTGGAATCCTGG - Intronic
1087374060 11:97320839-97320861 CCCCATGAGGCCATCAGTGCGGG - Intergenic
1088407571 11:109498374-109498396 CCTCATGAGGTCATCGGTGCAGG + Intergenic
1088678865 11:112222168-112222190 CCCCTTCAGGTCTTTAGTCCTGG + Intronic
1089139705 11:116275873-116275895 CCCCAAGAGGACTCCAGGCCTGG + Intergenic
1089903650 11:122013900-122013922 CCCCATGAGGCCATCAGTACAGG - Intergenic
1090891757 11:130929824-130929846 CCCCATGAGGCCATAAGTACAGG + Intergenic
1091714802 12:2769031-2769053 CCCCATCAGTTCTTCAGAGCAGG + Intergenic
1092381600 12:8001227-8001249 CCCCATGAGGCCATCGGTGCAGG - Intergenic
1092919231 12:13215736-13215758 CCCCAAGAGGTGATCACTCCAGG - Exonic
1093031826 12:14295640-14295662 CCCCATGAGGCCATCAGTGAAGG + Intergenic
1093341666 12:17982681-17982703 CCCCACGAGGTGTCCTGTCCAGG - Intergenic
1093964581 12:25311242-25311264 CCCCATAAGGCCATCAGTGCAGG - Intergenic
1094714286 12:32996858-32996880 ACCCTTGAGGTCCTCATTCCTGG + Intergenic
1095856207 12:46863387-46863409 CCTCATGAGGTCATTAGTGCAGG + Intergenic
1096288753 12:50323245-50323267 CCCCATGAGGCCATCGGTGCAGG - Intergenic
1097437797 12:59571965-59571987 CCCCATGAGGCCATCAGTGCAGG + Intergenic
1097554643 12:61121900-61121922 CCCCATGAGGCCATCAATGCAGG - Intergenic
1098749884 12:74279878-74279900 CCCCATGAGGCCTTCAGTGCAGG - Intergenic
1099735820 12:86565325-86565347 TCCCATGAGGCCATCAGTGCAGG - Intronic
1100276736 12:93078302-93078324 GCCCATGAGGCTGTCAGTCCTGG + Intergenic
1103396568 12:120611736-120611758 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1104550592 12:129753238-129753260 GCCCATGAGGCCTTCACTCCAGG - Intronic
1104769980 12:131355503-131355525 CCCCATGATGTGCTCTGTCCAGG - Intergenic
1105295560 13:19085760-19085782 CCCCATGAGGTCTGCACTGTGGG + Intergenic
1105779922 13:23696689-23696711 TGCCGTGGGGTCTTCAGTCCAGG - Intergenic
1108596781 13:51956280-51956302 CCCCATGGGGTCTGCAGGGCTGG - Intronic
1109883510 13:68512240-68512262 CTCCATGAGGGCCTCAGCCCTGG - Intergenic
1110377206 13:74806758-74806780 CCCTATGAGGCCTTCAGTGCAGG - Intergenic
1110834098 13:80064340-80064362 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1111057763 13:82972737-82972759 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1112231089 13:97589875-97589897 CCCCATGAGGCCATCAGTGCAGG + Intergenic
1115143441 14:30199662-30199684 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1116068134 14:40009457-40009479 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1117292835 14:54350167-54350189 CGCCATGGGGGCCTCAGTCCTGG + Intergenic
1118589153 14:67388183-67388205 GCCCCTGAGATCTTCAGGCCAGG + Intronic
1120231395 14:81844963-81844985 CCTCATGAGGCCATCAGTGCAGG + Intergenic
1122355876 14:101122580-101122602 CCACCTGAGTTCTCCAGTCCTGG - Intergenic
1202935441 14_KI270725v1_random:83409-83431 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1123902128 15:24887761-24887783 GCCCATGAGGTCTGCATGCCAGG + Intronic
1124614088 15:31229168-31229190 CCCCATGCAGACTTCAGCCCAGG - Intergenic
1126220742 15:46209755-46209777 GCCCATGAGGGCATCAGCCCTGG + Intergenic
1127260045 15:57320687-57320709 CGCCTTGAGGTCTGCAGGCCGGG - Intergenic
1127356949 15:58209477-58209499 CCCCATGAGGCCGTCGGTGCAGG - Intronic
1129951134 15:79592560-79592582 CCCCACAAGGTTTCCAGTCCTGG + Intergenic
1131417994 15:92277591-92277613 CCCTATGAGGTCATCAGTGTGGG - Intergenic
1132219224 15:100092825-100092847 CTCAGTGAGGACTTCAGTCCAGG + Intronic
1132999024 16:2839953-2839975 CCCCATGAGGTCTGCATTGAGGG + Intergenic
1135937924 16:26796831-26796853 ACCCCTGAGATTTTCAGTCCTGG - Intergenic
1136041567 16:27583568-27583590 GGCCATGGGGGCTTCAGTCCTGG + Intronic
1138868418 16:60851071-60851093 CCCGATGAGGCCCTCAGTTCAGG - Intergenic
1139449256 16:67016883-67016905 CCCCAAGAGGTGTCCAGTCCAGG + Intergenic
1141151673 16:81568541-81568563 CCCCATCAGGCCTTCACTCTTGG - Intronic
1142410094 16:89911547-89911569 CCCCACGGGGTCTTCAGTGCAGG + Intergenic
1143050075 17:4118076-4118098 CCCCATGAGGCCATCGGTACAGG + Intronic
1143576126 17:7794353-7794375 CCCCATGAGGTCCTCACTGTGGG - Exonic
1145127422 17:20313898-20313920 CCCCTCAAGGACTTCAGTCCAGG - Intronic
1146850974 17:36221327-36221349 CCCCATGAGGCCATCAGTGCAGG - Intronic
1148850390 17:50551753-50551775 CTCCATGTGGACTCCAGTCCTGG + Intronic
1153089751 18:1330446-1330468 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1153131237 18:1857416-1857438 CCCCATGAGGCCATCACTGCAGG + Intergenic
1154068500 18:11131383-11131405 CCCCATGAGGCCATCGGTGCAGG - Intronic
1154252633 18:12756990-12757012 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1154506209 18:15043182-15043204 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1156303900 18:35858979-35859001 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1157570203 18:48707137-48707159 CCCCATGTAGACATCAGTCCAGG - Intronic
1157587637 18:48814956-48814978 GCCCATGAGGTCTGCAGGCATGG + Intronic
1158617793 18:59004134-59004156 CCCCATGTGGTCTTTCCTCCAGG - Intergenic
1158884597 18:61814970-61814992 CCCAATGAAGTCTTCATCCCAGG + Exonic
1159151864 18:64532465-64532487 CCCCATGAGGTCATTGGTGCAGG + Intergenic
1159559064 18:69975079-69975101 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1159711337 18:71764408-71764430 CCCCATGAAGCCCTCAGTGCAGG - Intronic
1164095998 19:22010550-22010572 CCCCAAGAGGGCTCCAGGCCAGG + Intronic
1164097049 19:22021067-22021089 CCCCCTTAGGTCATCAGTGCAGG + Intergenic
1164115498 19:22215405-22215427 CCCCAAGAGGGCTCCAGGCCAGG + Intergenic
1164117221 19:22234289-22234311 CCCCATTAGGTCATCAGTGCAGG + Intergenic
1164199174 19:23002782-23002804 CCCCAAGAGGGCTCCAGGCCAGG + Intronic
1166116921 19:40662153-40662175 CCTCATGAGGTTTTCTGTGCAGG + Intergenic
1167788018 19:51651668-51651690 CCCCATGATGTCTCCAGCCTGGG + Intergenic
925713239 2:6761981-6762003 CACCATGGGACCTTCAGTCCCGG + Intergenic
926323884 2:11767698-11767720 CCCCATGAGGTCTCCTGTCCTGG + Intronic
926826803 2:16913953-16913975 CCCCATGAGGCCATCAGTGCAGG - Intergenic
927008755 2:18880009-18880031 CCCCATGAGACCATCAGTGCAGG - Intergenic
929269784 2:39960513-39960535 CCCCATGAGGCCATCGGTGCAGG + Intergenic
930536571 2:52651977-52651999 CCCCATGAGGCCACCAGTGCAGG + Intergenic
930736701 2:54787068-54787090 CCCACTGAGGTCTCCAGGCCAGG + Intronic
930910186 2:56621155-56621177 CCCCATGAGGCCGTCAGTGCAGG - Intergenic
931455796 2:62408998-62409020 CCCCCAGAGGTCTCCAGTCAGGG + Intergenic
933394434 2:81713069-81713091 CCCCATGAGGCCATCAGGGCAGG + Intergenic
933507849 2:83201788-83201810 TCACATTAGTTCTTCAGTCCTGG + Intergenic
934305781 2:91820881-91820903 CCCCATGAGGTCATCAGTGCAGG - Intergenic
934327475 2:92031861-92031883 CCCCATGAGGTCATCAGTGCAGG + Intergenic
934465862 2:94262441-94262463 CCCCATGAGGTCATCAGTGCAGG + Intergenic
934855813 2:97729075-97729097 TCCAAAGAGGTCTGCAGTCCAGG - Intronic
935183975 2:100715185-100715207 CCCCATGAGGCCATCGGTGCAGG - Intergenic
936058022 2:109275993-109276015 CCCCATTTGGTCTCCAATCCTGG + Intronic
937582025 2:123498880-123498902 CCCCATGAGGCCATCGGTGCAGG + Intergenic
937800364 2:126075014-126075036 CCCCATGAGGCTGTCAGTGCAGG - Intergenic
938708117 2:133951563-133951585 CACCATGTTCTCTTCAGTCCAGG + Intergenic
939069113 2:137518184-137518206 CCCCATGAGGCCATCAGTGCAGG - Intronic
939788645 2:146545826-146545848 CCCCATGAGGCCATCAGTGCAGG + Intergenic
940171279 2:150832425-150832447 CCCCATGAGGCCATCGGTGCGGG + Intergenic
940605879 2:155924001-155924023 CCCCATGAGGCCATCAGTGCAGG + Intergenic
940770921 2:157838820-157838842 CCTCATAAGGTCTCCAATCCTGG + Intronic
941594343 2:167456819-167456841 CTCCATGTGTTCATCAGTCCAGG + Intergenic
943283882 2:185972306-185972328 CTCCATGAGGGCTTCACCCCTGG - Intergenic
943480564 2:188411988-188412010 CCCCGTGAGGCCATCAGTGCAGG + Intronic
944584421 2:201160949-201160971 CCCCAGGAGGTGGTCAGTTCCGG + Intronic
945725806 2:213471216-213471238 CCCCATGAAGCCATCAGTGCAGG + Intronic
946527829 2:220539685-220539707 CTCCATGAGGGCATCAGTGCAGG + Intergenic
946703730 2:222437505-222437527 CCCCATGAGGCCATCGGTGCAGG + Intronic
947440882 2:230120541-230120563 CTCCATGAGGTCATCAGTGCAGG - Intergenic
948657745 2:239487123-239487145 CCCTGTGAAGTCCTCAGTCCTGG - Intergenic
949060020 2:241951350-241951372 CCCCATGGGGTTTACAGTGCAGG - Intergenic
1170822740 20:19767992-19768014 CCCTCTGAGGGCTTCAGTCCAGG + Intergenic
1172314624 20:33944079-33944101 CCCTATGAGGTATTCAGTCAAGG + Intergenic
1173585837 20:44182454-44182476 GCCCAGGAGCTCTTCAGGCCAGG - Intronic
1175781604 20:61685750-61685772 CCCCGTGAGGACTGGAGTCCAGG - Intronic
1176376040 21:6087280-6087302 CCCCATGAGGTCAGGAGGCCTGG - Intergenic
1176596862 21:8705645-8705667 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1176791644 21:13325841-13325863 CCCCATGAGGCCATCAGTGCAGG + Intergenic
1177537618 21:22448784-22448806 CCACAAGAGGTCTTCAGACAAGG + Intergenic
1177569555 21:22870321-22870343 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1177913219 21:27056497-27056519 CTCCATGAGGCCATCAGTGCAGG - Intergenic
1177990134 21:28027475-28027497 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1178012698 21:28305462-28305484 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1179747435 21:43450964-43450986 CCCCATGAGGTCAGGAGGCCTGG + Intergenic
1180279782 22:10683087-10683109 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1180587000 22:16901613-16901635 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1180591110 22:16938080-16938102 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1181079930 22:20407091-20407113 CCCCATCAGGTCTGCATGCCAGG + Exonic
1181089719 22:20464330-20464352 CAGCATGCGGTCTTCAGCCCAGG - Intronic
1181420694 22:22796116-22796138 CCCCATGAGGCCATCGGTGCAGG - Intronic
1184630305 22:45772807-45772829 ACCCATGGGGTATTCATTCCAGG + Intronic
949125625 3:442860-442882 CCCCATGAGGCCACCAGTGCAGG + Intergenic
949245907 3:1925209-1925231 CCCCAAGAGGCCATCAGTGCAGG - Intergenic
949417548 3:3830600-3830622 CCCCATGAGGCCATCAGGGCAGG + Intronic
949638817 3:6012803-6012825 CCCCATGAGGCCAGCAGTGCAGG - Intergenic
950430552 3:12948441-12948463 CCCCATGAGCTCCCCAGTCCAGG - Intronic
951291479 3:20876459-20876481 CCCCATGAGGCCATCAGTGCAGG + Intergenic
952231847 3:31439505-31439527 CCACATGGGTTCATCAGTCCTGG + Intergenic
954054198 3:48008251-48008273 CCCCATGAGGCCATCAGTGCAGG - Intronic
954511449 3:51129378-51129400 CCCCATGAGGCCATCAGTGCAGG + Intronic
956524271 3:70140248-70140270 CTCCATGAGATCTTCGGACCTGG - Intergenic
958487641 3:94732188-94732210 CCCCATGAGGCCATCGGTGCAGG + Intergenic
958934341 3:100240898-100240920 CCCCATGAGGCCATCGGTGCAGG - Intergenic
959745973 3:109776987-109777009 CCCCATGAGGCCATCAGTGCAGG + Intergenic
960349566 3:116575987-116576009 CCCCATGAGACCATCAGTGCAGG - Intronic
960494707 3:118360494-118360516 CCCCATGAGGCCATCAGTGCAGG + Intergenic
964679200 3:159318628-159318650 CCCCCTGAGGCCATCAGTGCAGG + Intronic
966044292 3:175530635-175530657 CCCCATGAGGCTTGCAGTGCAGG + Intronic
967831822 3:193926276-193926298 CCCCATGAGGCCATCAGTGCAGG - Intergenic
969858106 4:10016017-10016039 CCCGAGGAGGCCTTGAGTCCAGG - Intronic
972095535 4:35342975-35342997 CCCCATGATGCCATCAGTACAGG - Intergenic
972805953 4:42529614-42529636 CCCCATGAGGCCATCGGTGCAGG - Intronic
973130154 4:46639412-46639434 CCCCATGAGGCCATCAGTGTAGG + Intergenic
974289608 4:59913027-59913049 CCCCATGAGGTCATCAGTGCAGG - Intergenic
974564829 4:63568595-63568617 CCCCATGAGGTTATCGGTGCAGG - Intergenic
974727254 4:65812808-65812830 CCCCATGAGGCCATCAGTGCAGG - Intergenic
977430801 4:96928495-96928517 CCCCATGAGGCCATCGGTACAGG - Intergenic
977490038 4:97699786-97699808 CCCCATGAGGCCATCAGTGCAGG + Intronic
977626233 4:99192368-99192390 CCCCATGAGGCCTTCAGTGCAGG + Intergenic
977898745 4:102394874-102394896 CCCCATGAGGCCATTGGTCCAGG - Intronic
977930370 4:102743533-102743555 CCCCATGAGGCCATTAGTGCAGG + Intronic
978341548 4:107725263-107725285 CCCCATGAGGCCATCAGTGCAGG + Intergenic
978966888 4:114751228-114751250 CCCCATGAGGCCGTCGGTACAGG - Intergenic
979767053 4:124474881-124474903 CCTCATGAGGCCATCAGTGCAGG - Intergenic
980387908 4:132110895-132110917 ACCCATGAGGCCATCAGTGCAGG + Intergenic
980629565 4:135414577-135414599 CTTCATGAGGTCATCAGTGCAGG - Intergenic
980957770 4:139446202-139446224 CCCCATGAGGCCATCGGTGCAGG - Intergenic
982597735 4:157406746-157406768 CCCCATAAGGCCATCAGTTCAGG + Intergenic
982835582 4:160116927-160116949 CCCCATGAGGCCATCAGTGCAGG - Intergenic
983185103 4:164691860-164691882 CCCCATGAGGCCATCAGTGCAGG - Intergenic
983844102 4:172494993-172495015 CTCCATGAGGTGTTCAGTGAGGG - Intronic
985318550 4:188683802-188683824 CTCCATGTGGTCTTCATTCTAGG - Intergenic
986531368 5:8740041-8740063 CCCCATGAGGCCATCGGTGCAGG + Intergenic
986742958 5:10719792-10719814 CCTCATGAGGCCATCAGTGCAGG - Intronic
986959874 5:13199480-13199502 CCCCATGAGGCCTTTGGTGCAGG - Intergenic
987252245 5:16111832-16111854 CCCCATGATGTGTGCAGTCTAGG + Intronic
987657101 5:20821365-20821387 CCCCATGAGGCCATCAGTGCAGG + Intergenic
988079788 5:26401141-26401163 CCCCAAGAGGCCATCAGTGCAGG + Intergenic
988562169 5:32291126-32291148 CCCCATGAGGTCATCGGTGCAGG - Intronic
988766450 5:34382583-34382605 CCCCATGAGGCCATCAGTGCAGG - Intergenic
989307463 5:39974337-39974359 CCCCATGATGCCATCAGTGCAGG + Intergenic
989486342 5:41996072-41996094 CCCCATGAGGCCATCAGTGCAGG + Intergenic
991946182 5:71900428-71900450 CCCCATGAGGCCATCGGTGCAGG - Intergenic
994291330 5:98031665-98031687 CCCCATGAGGCCATCAGTGCAGG + Intergenic
994855398 5:105113297-105113319 CCCCATGAGGCCATCAGTGCAGG + Intergenic
994916995 5:105993763-105993785 CCCCATGAGGCCATCAGTGCAGG - Intergenic
996825601 5:127678126-127678148 CCCCATGAGGCCATCGGTGCAGG - Intergenic
996891726 5:128428513-128428535 CCCCATCAGGAATTCAGCCCTGG + Intronic
999630343 5:153564280-153564302 CCCCATGAAGTCTTCCCTCTGGG - Intronic
1000223220 5:159234071-159234093 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1003595064 6:7467255-7467277 GGCCTTGAGGTCTTCAGTCAGGG + Intergenic
1003791266 6:9550332-9550354 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1004824258 6:19402948-19402970 CCCCATGAGGTCATAGGTGCAGG + Intergenic
1005358779 6:25010340-25010362 CCCCATGAGCTCTACAGAGCTGG + Intronic
1006818444 6:36870460-36870482 CCCCAAGATGTTTTCAGTCGCGG - Intronic
1008079341 6:47178284-47178306 CCTCATGAGGTCATCAGTGCAGG + Intergenic
1008340309 6:50356653-50356675 CCCCAGGAGGCCATCAGTGCAGG - Intergenic
1009390076 6:63134790-63134812 CCCCATGAGGCCATCAGTGCAGG + Intergenic
1009660653 6:66606635-66606657 CCCCATGAGGCCATCAGTGCAGG + Intergenic
1009851885 6:69208670-69208692 CCCCATGAGGCCATCAGTGCAGG + Intronic
1010325291 6:74556311-74556333 CCCCATGAGGCCATCAGTGTAGG + Intergenic
1010938206 6:81886124-81886146 CCCAATGAGGCCATCAGTGCAGG + Intergenic
1012920756 6:105219257-105219279 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1014534152 6:122596318-122596340 CCCCATGAGGCCATCGGTGCAGG + Intronic
1015466808 6:133557428-133557450 CTCCATGAGGTCATCGGTGCAGG + Intergenic
1017227767 6:152040804-152040826 CCCCATGAGGCCATCAGTGCAGG + Intronic
1017388417 6:153911935-153911957 CTCCATGAGGCCATCAGTGCAGG + Intergenic
1017451277 6:154556762-154556784 CCCCATTAGAACTTCAGGCCAGG + Intergenic
1018803749 6:167242705-167242727 CCCCATGAGGCCAACAGTGCAGG + Intergenic
1019998047 7:4737785-4737807 ACCCAAGGGCTCTTCAGTCCTGG - Intronic
1020710388 7:11597913-11597935 CCCCATGAGGCCATCGGTACAGG - Intronic
1024203202 7:47126846-47126868 CCCCGGGAGGTCTTCTGTCCTGG + Intergenic
1024980321 7:55152726-55152748 CCACAGGAAGTCTTCTGTCCTGG - Intronic
1026046449 7:66908812-66908834 CCCCATGAGGCCATCATTTCAGG + Intergenic
1026140491 7:67701664-67701686 ACCCATGAAGCCATCAGTCCTGG - Intergenic
1028141775 7:87282269-87282291 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1028935053 7:96455350-96455372 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1030355529 7:108538352-108538374 CCCCATGAGGCCATCAGTGCAGG - Intronic
1030457419 7:109792765-109792787 CCCCATGAGGCCATCAGTGCAGG + Intergenic
1030931248 7:115525396-115525418 CCCCATGAGGCCATCATTTCAGG + Intergenic
1032153064 7:129446671-129446693 CCCCATGAGGCCATCAGTGCAGG + Intronic
1032281723 7:130508618-130508640 CACCATGAAGTTTACAGTCCGGG - Exonic
1032790568 7:135239499-135239521 CCCCATTAGGTGCTCAGTACTGG - Intronic
1033559936 7:142521600-142521622 ACCCATGTGGTCTCCACTCCTGG - Intergenic
1033817485 7:145091891-145091913 CTCCAGGATGTCTTCACTCCAGG + Intergenic
1035302957 7:157909461-157909483 CACAGTGAGGTCTACAGTCCAGG + Intronic
1037364546 8:18107975-18107997 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1037400934 8:18494629-18494651 CCCCATGAAGTGCTGAGTCCTGG + Intergenic
1040550096 8:48430946-48430968 CCACATGGGGTCTTGAGTCTTGG + Intergenic
1041934592 8:63321616-63321638 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1044285934 8:90412161-90412183 CCCCATGAGGCCATCAGTGCAGG + Intergenic
1048621048 8:136133326-136133348 TCCCATCAGGACTTCATTCCTGG + Intergenic
1049184956 8:141245456-141245478 CTCCATCACGTCTTCTGTCCAGG + Intronic
1052368693 9:27641122-27641144 CCCCATGAGGCCATCAGTGCAGG - Intergenic
1052442227 9:28511996-28512018 CCCCATGAGGTCATCAGTGCAGG + Intronic
1053018042 9:34675258-34675280 CCCCATGAGGTTGAGAGTCCAGG - Intergenic
1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1054307166 9:63438435-63438457 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1054405898 9:64762427-64762449 CCCCATGAGGCCATCAGTGCAGG + Intergenic
1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1054490882 9:65774025-65774047 CCCCATGAGGTCATCAGTGCAGG - Intergenic
1055249279 9:74282720-74282742 CCACATGGCCTCTTCAGTCCTGG - Intergenic
1055630597 9:78219775-78219797 TCCCTTGAGGTCTCTAGTCCTGG + Intergenic
1055903900 9:81270919-81270941 CCCCATGAGGACATCTGTACAGG + Intergenic
1056156703 9:83845489-83845511 CCCCATGAGGCCATCGGTGCAGG - Intronic
1056353835 9:85778038-85778060 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1058259221 9:102809398-102809420 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1058544130 9:106042469-106042491 CCCCATGAGACCATCAGTGCAGG + Intergenic
1059627269 9:116080691-116080713 CCTCAGAAGGCCTTCAGTCCCGG + Intergenic
1062135512 9:134925300-134925322 CCCCATGAGGCCATCGGTGCAGG - Intergenic
1202778366 9_KI270717v1_random:12830-12852 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1186279540 X:7977404-7977426 CCCCATGAGGCCATCGGTGCAGG - Intergenic
1186384057 X:9091476-9091498 CCCCATGAGGCCATCAGTACAGG + Intronic
1187604908 X:20872148-20872170 CCCCACGAGGCCATCAGTGCAGG - Intergenic
1190772533 X:53527213-53527235 CTCCATGAGGGCTTCACCCCTGG - Intergenic
1191629997 X:63312303-63312325 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1191932954 X:66394448-66394470 CCCTATGAGGCCTTCAGTGCAGG - Intergenic
1192898738 X:75472189-75472211 CCCCATGAGGCCATCAGTGCAGG - Intronic
1193925626 X:87479993-87480015 ACCCATGAGTTCTCCAGTGCGGG - Intergenic
1194870751 X:99128159-99128181 CCCCTTGAGGTCATATGTCCAGG - Intergenic
1195554887 X:106210600-106210622 CCCCATGAGGTGTGCAGTGCTGG - Intergenic
1195809748 X:108816565-108816587 CCCCATGAGGCCATCGGTGCAGG + Intergenic
1197477318 X:126941045-126941067 CCCCATGAGGCCATCAGTGCAGG + Intergenic
1199853844 X:151743914-151743936 CGTCCTCAGGTCTTCAGTCCTGG + Exonic
1200257603 X:154592735-154592757 GCCCATGAGCTCTCCAGTCTGGG - Intergenic
1200651707 Y:5848033-5848055 CCACATGAGGCCATCAGTGCAGG - Intergenic
1201193679 Y:11471134-11471156 CCCCATGAGGTCATCAGTGCAGG + Intergenic
1201529617 Y:14977606-14977628 CCCCATGAGGCCATCAGTGCAGG + Intergenic