ID: 1070568793

View in Genome Browser
Species Human (GRCh38)
Location 10:77625014-77625036
Sequence CTCCTGGAGGGGGAATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070568785_1070568793 -2 Left 1070568785 10:77624993-77625015 CCCAAAGATAATGCTGGTCATCT 0: 1
1: 0
2: 3
3: 10
4: 146
Right 1070568793 10:77625014-77625036 CTCCTGGAGGGGGAATTTGGAGG No data
1070568786_1070568793 -3 Left 1070568786 10:77624994-77625016 CCAAAGATAATGCTGGTCATCTC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1070568793 10:77625014-77625036 CTCCTGGAGGGGGAATTTGGAGG No data
1070568782_1070568793 29 Left 1070568782 10:77624962-77624984 CCGTAAAGAACATGTCAGGGAAG 0: 1
1: 0
2: 0
3: 24
4: 210
Right 1070568793 10:77625014-77625036 CTCCTGGAGGGGGAATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070568793 Original CRISPR CTCCTGGAGGGGGAATTTGG AGG Intronic
No off target data available for this crispr