ID: 1070570725

View in Genome Browser
Species Human (GRCh38)
Location 10:77637963-77637985
Sequence CCCCGGGCGCGGGCGGCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 479}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070570725_1070570734 4 Left 1070570725 10:77637963-77637985 CCGCGGGCCGCCCGCGCCCGGGG 0: 1
1: 0
2: 3
3: 64
4: 479
Right 1070570734 10:77637990-77638012 CGCCGCCCCCGGGCCCGCCCCGG 0: 1
1: 0
2: 12
3: 134
4: 852
1070570725_1070570740 16 Left 1070570725 10:77637963-77637985 CCGCGGGCCGCCCGCGCCCGGGG 0: 1
1: 0
2: 3
3: 64
4: 479
Right 1070570740 10:77638002-77638024 GCCCGCCCCGGCTCCGCGCGCGG 0: 1
1: 1
2: 2
3: 36
4: 310
1070570725_1070570745 22 Left 1070570725 10:77637963-77637985 CCGCGGGCCGCCCGCGCCCGGGG 0: 1
1: 0
2: 3
3: 64
4: 479
Right 1070570745 10:77638008-77638030 CCCGGCTCCGCGCGCGGTCCCGG 0: 1
1: 0
2: 0
3: 16
4: 216
1070570725_1070570747 23 Left 1070570725 10:77637963-77637985 CCGCGGGCCGCCCGCGCCCGGGG 0: 1
1: 0
2: 3
3: 64
4: 479
Right 1070570747 10:77638009-77638031 CCGGCTCCGCGCGCGGTCCCGGG 0: 1
1: 0
2: 1
3: 23
4: 179
1070570725_1070570731 -7 Left 1070570725 10:77637963-77637985 CCGCGGGCCGCCCGCGCCCGGGG 0: 1
1: 0
2: 3
3: 64
4: 479
Right 1070570731 10:77637979-77638001 CCCGGGGTCTGCGCCGCCCCCGG 0: 1
1: 0
2: 5
3: 28
4: 257
1070570725_1070570733 -6 Left 1070570725 10:77637963-77637985 CCGCGGGCCGCCCGCGCCCGGGG 0: 1
1: 0
2: 3
3: 64
4: 479
Right 1070570733 10:77637980-77638002 CCGGGGTCTGCGCCGCCCCCGGG 0: 1
1: 0
2: 5
3: 23
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070570725 Original CRISPR CCCCGGGCGCGGGCGGCCCG CGG (reversed) Intronic
900372125 1:2336752-2336774 ACCCAGGCGGGGGCGGCCCCAGG + Exonic
900386405 1:2412892-2412914 CCCAGTGGGAGGGCGGCCCGTGG - Intronic
900393488 1:2443797-2443819 CCGCCAGCTCGGGCGGCCCGCGG - Intronic
900671298 1:3856807-3856829 CGCGGGGCGCGGGCGCCGCGGGG - Intronic
901018680 1:6245329-6245351 CTCCGGCCGCCGGCGGCCCGCGG + Exonic
901098569 1:6701913-6701935 CGCCGGGCGCGGACGGCTCCGGG - Exonic
901641264 1:10694263-10694285 GCGCGGGCGGGGGAGGCCCGGGG - Intronic
901673101 1:10867297-10867319 CGGCGGCCGCGGGCGGCGCGGGG + Intergenic
902323556 1:15684251-15684273 CCCCAGGCGCAGGCGGGCCCTGG + Intergenic
902600883 1:17539668-17539690 CCCCGGGACCGGGCGGGCGGGGG + Intergenic
903044272 1:20553819-20553841 CCCCCAGCGCGAGCGGCCGGAGG + Exonic
903349806 1:22710893-22710915 CCCCGGGCTCGGGGGGCCAGGGG - Intronic
904006631 1:27366475-27366497 CCCCGGGCCGGGGCTGCGCGCGG - Exonic
904045191 1:27604294-27604316 CCCCAGGCGCGGGGTCCCCGGGG - Intronic
904236569 1:29121123-29121145 CCCAGGGTGGGGGCAGCCCGGGG + Exonic
904500154 1:30908594-30908616 GCGCGGGCGCGGGCGGCGGGCGG + Exonic
904600726 1:31671303-31671325 CCCCTGCCGAGGGCGGCCTGGGG + Intronic
904606524 1:31700935-31700957 CCCAGGGCGAGGGAGGCCCATGG - Intronic
904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG + Intronic
904775082 1:32901420-32901442 CTGCGGGGCCGGGCGGCCCGGGG - Intronic
904822936 1:33256793-33256815 CCCGAGGCGCAGGCGGCCCCGGG - Intronic
904831102 1:33307308-33307330 CCCGGGACGCCGGCTGCCCGTGG - Exonic
905037827 1:34929347-34929369 CCCGGGGCGTGGGCGGCGCCGGG + Intronic
905308466 1:37034319-37034341 CCTCGCTCGCGGGCAGCCCGTGG - Intergenic
905717067 1:40161319-40161341 CACAGTGCGCGGGCGGCCGGGGG + Intergenic
906044418 1:42817079-42817101 CCCTGGGGCCGGGCGGGCCGGGG - Intronic
906130710 1:43453712-43453734 CCCCGCGCGGGTGCGGGCCGCGG - Exonic
906403344 1:45521729-45521751 ACCCGAGCGCGGGCGGGCCCCGG + Exonic
906627141 1:47334262-47334284 CGCCGCGCGCCGGCGGCCCTCGG - Intronic
906640553 1:47438379-47438401 CCCCGCGCTCTGGCGTCCCGGGG + Exonic
906805597 1:48776647-48776669 CCCCAGTCGCGGGGGGCGCGCGG + Exonic
908473775 1:64470000-64470022 CCCCGGCCCCCGGCGTCCCGGGG + Intergenic
908501022 1:64744633-64744655 TCCCGCGCTGGGGCGGCCCGGGG - Intergenic
912305245 1:108560277-108560299 CCCCGGCCGCGGCCGGCCTGCGG + Exonic
914813691 1:151047899-151047921 CCCCGGGCGGCGGGGGCCCAAGG + Exonic
915977497 1:160400650-160400672 CCCCGGGGGCTGGGGGCCAGGGG - Exonic
916667052 1:166975788-166975810 TCCCGAGCGCGGGCGTCCCTGGG - Intronic
919451332 1:197775592-197775614 CCCCGCGCCCGGGCGGCCAGAGG + Intronic
920184585 1:204152075-204152097 GCCGGGGCGGGGGCGGGCCGGGG - Intergenic
922250635 1:223845994-223846016 CCGCGGGCGGGGTCGGCGCGGGG - Intergenic
923056031 1:230426338-230426360 TCCCGGGCGCGAGCCGCCAGAGG + Intergenic
923684127 1:236142371-236142393 GCCCGGGGGAGGGCGGGCCGGGG + Intergenic
923684292 1:236143085-236143107 CCCCTGCCTCGGGCGCCCCGCGG - Intronic
923712039 1:236395560-236395582 TCCGGGGCGCGGGAGGACCGTGG - Intronic
923744400 1:236686812-236686834 CACCACGCGCGGGCGGCCCGCGG - Intronic
924415220 1:243850468-243850490 CCCGGGGCGCGCCCGGCGCGGGG + Intronic
1062774549 10:135031-135053 CTCCGAGGGCGGGCGGGCCGAGG + Intronic
1062843600 10:689147-689169 CCCAGGGCGCGGGGGGATCGCGG + Intronic
1062890467 10:1056450-1056472 CCCTGAGCGCAGGCGGCCCCGGG + Intronic
1062890476 10:1056480-1056502 CCCGGGGCGCGGTCCGCCTGAGG - Intronic
1064107609 10:12513248-12513270 CCCTGGACGCGGGCAGCCCTGGG + Intronic
1064354325 10:14604091-14604113 CCCCGTGCGCGGGAGGGCAGCGG - Intronic
1065023119 10:21517028-21517050 CGGCGGGCGCCGGAGGCCCGGGG - Exonic
1066464417 10:35640377-35640399 CGCCGGGCGCGGGGGGCGCTGGG - Exonic
1067694329 10:48524142-48524164 CCCGGGGCGCAGGCGGCAGGCGG - Intronic
1067769812 10:49115310-49115332 CTCCGGGCGCGGGCGGGGGGCGG - Intronic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070570725 10:77637963-77637985 CCCCGGGCGCGGGCGGCCCGCGG - Intronic
1071532573 10:86401019-86401041 ACCCTGGGGCGGGCGGCGCGGGG - Intergenic
1072710674 10:97713907-97713929 CCCCAGGCGCGTGCGGCCCGCGG + Exonic
1072994274 10:100229488-100229510 GGCCGGGCGCGGGCGGGCCCTGG - Exonic
1073363606 10:102919076-102919098 CCCTGGGCGCCGGCGGCTCGGGG + Exonic
1073460091 10:103661229-103661251 CCCCGGCTGCGGGCTGCCCCTGG - Intronic
1074086178 10:110210156-110210178 CCCCGCGCGGGGCGGGCCCGTGG + Intronic
1075037366 10:119080585-119080607 CGCCGGGCTGGGGCGGCCCGAGG - Intronic
1075048636 10:119165716-119165738 CTGCGGGTGCGCGCGGCCCGGGG - Intergenic
1075129541 10:119726226-119726248 CCCAGGGAGGCGGCGGCCCGCGG - Exonic
1075144615 10:119872627-119872649 GCCCGGCCGCGCTCGGCCCGCGG - Exonic
1075748287 10:124743413-124743435 TCCCGGGCGGGGGAAGCCCGCGG - Intronic
1076035282 10:127195239-127195261 CCCCGACCCCGGGCTGCCCGCGG + Intronic
1076372442 10:129964185-129964207 TCCCGGGCGCAGGCGGGGCGCGG + Intergenic
1076406081 10:130213381-130213403 GCCCAGGTGCGGGCGGCTCGAGG + Intergenic
1076722207 10:132397568-132397590 CGCCGGGCCGGGGCGGGCCGGGG + Intronic
1077008411 11:369616-369638 CCGCGGCCGAGGGCGGCCTGGGG + Intergenic
1077008531 11:370008-370030 CGGGGGGCGCGGGCGGCGCGGGG + Intronic
1077250111 11:1557144-1557166 CGCCGGGGTCGGGGGGCCCGGGG + Exonic
1077495275 11:2884207-2884229 CGCGGGGCGCGGGCCGGCCGGGG + Intronic
1078090741 11:8263096-8263118 CCCGGGGGGCGTGCGGCCCCGGG + Intronic
1078090746 11:8263112-8263134 CCCCGGGCGCGTGCAGCCCGGGG + Intronic
1078168475 11:8910968-8910990 CGCCGGGCGCTGGGGGCCGGGGG - Intergenic
1078429767 11:11280134-11280156 CCCCGGGCGGGGGGTGCCCTGGG - Intronic
1079353454 11:19712616-19712638 CCCCGGCCGCGCGCCTCCCGGGG - Intronic
1080283593 11:30585375-30585397 CGGCGCGCGCGGGCGGCCCCGGG + Intronic
1080802159 11:35618835-35618857 CCCCTGGCGTGGGACGCCCGCGG + Exonic
1081834427 11:46142696-46142718 GCCGGGGCGCGGGCAGCCCGGGG + Intergenic
1082002392 11:47400297-47400319 CCCTGGGGGCGGGCGGCGCGGGG - Intergenic
1083662705 11:64259159-64259181 CGCCGGGCGCAAGCGGCCCCTGG + Exonic
1083722023 11:64607913-64607935 CCCAGAGGGCGGGCGGCGCGCGG + Exonic
1083747796 11:64745065-64745087 CCCCGAGGGCGGGCGACCGGAGG + Intronic
1083876084 11:65525088-65525110 GCCCCGGCTCGGGCGGCCGGAGG + Exonic
1083952051 11:65961966-65961988 GCGCGGGAGCGGGCGGCGCGGGG + Exonic
1084070113 11:66728299-66728321 CACGGGGCGCAGGCGGCGCGGGG + Intronic
1084070146 11:66728421-66728443 CCGCGGGAGCCGGCGGCCTGCGG - Intronic
1084156913 11:67318202-67318224 TCCCGGGCGCTGGCAGCCCACGG + Intronic
1084174369 11:67415839-67415861 CCCCGGGCGCCCGCTCCCCGCGG + Intronic
1086888226 11:92226695-92226717 CCCGGAGCGTGGGCGGCCGGTGG + Intergenic
1088764333 11:112961867-112961889 CGCCGGGCGCTGGCGGCTCGGGG - Intronic
1089729507 11:120511630-120511652 CCCCGCGCACGGCCGGCCGGGGG - Intergenic
1089966161 11:122656247-122656269 CCGCGCGCGCGGCCGGCCCTCGG + Intronic
1090238269 11:125165107-125165129 GCAGGGGAGCGGGCGGCCCGCGG - Intronic
1091259808 11:134225055-134225077 ACCGGGGCGCGGGCTGCCCTAGG - Exonic
1091273046 11:134331738-134331760 CCCCGGCCGGGGGCGGGGCGGGG - Intergenic
1091473820 12:753068-753090 GCCCGGGCGGTGGCGGCCCCGGG - Exonic
1092428177 12:8390240-8390262 ACGCGGGCGCGGGGGTCCCGGGG - Intergenic
1092564232 12:9648066-9648088 CCCGGGGGGCGGGAGGCGCGAGG - Intergenic
1092843285 12:12562768-12562790 CTCCGGGCTCGGGCGGCCGCGGG - Intergenic
1093057212 12:14567545-14567567 CCCTGGGCGGGGGGCGCCCGGGG - Intronic
1093894518 12:24562060-24562082 CCCCGGGGGCGGCTGGCCGGGGG - Intergenic
1094040252 12:26114406-26114428 CCCGGGGCGCTGGCGGGCGGCGG - Intergenic
1094125039 12:27014445-27014467 CTCTGGGCGCGGGCGGCGCTGGG + Intergenic
1095206338 12:39443523-39443545 CCTCGGGCGAGGGCAGCCGGCGG - Intergenic
1095584498 12:43835796-43835818 CCCGTGGCGCACGCGGCCCGCGG + Intergenic
1095949253 12:47773121-47773143 TTCCGGGCGCGGGCGGCCTCCGG + Intronic
1096106279 12:48998438-48998460 CTCCGGGCGGGGTCGACCCGGGG + Exonic
1096271106 12:50167072-50167094 GCCCGGGAGCGAGCGGCTCGGGG - Intronic
1096674411 12:53218849-53218871 GCCTGGGTGCGGACGGCCCGGGG - Intronic
1097891373 12:64780822-64780844 CCACCGGCGGGGGCCGCCCGGGG + Intergenic
1099989561 12:89708562-89708584 CCCCGGCCGCGGGCGGGCGGCGG + Intronic
1100186528 12:92145541-92145563 CGGCGTGCGGGGGCGGCCCGGGG + Exonic
1101504061 12:105330653-105330675 CCCCGGGCGGGGCGGGGCCGGGG + Exonic
1102197189 12:111034060-111034082 CTCAGGGCCCGGGCGGCCGGCGG + Exonic
1102254056 12:111406025-111406047 TCCCCGGCGGCGGCGGCCCGGGG + Exonic
1102997344 12:117360813-117360835 CCCCCAGCCCGGGCTGCCCGCGG + Intronic
1103779434 12:123389205-123389227 CGCGGGGGGCGGGCGGCGCGCGG + Intronic
1103883213 12:124182495-124182517 CCCAGGGCGAGGGCTTCCCGAGG - Intronic
1104448775 12:128853377-128853399 CCCAGGGCTCGCGCCGCCCGAGG + Intergenic
1104568303 12:129903962-129903984 GCCCGGGGCCGGGCGGGCCGAGG - Intergenic
1105512299 13:21061135-21061157 CGCCGGGCGGGGGCGGCTCCGGG + Intronic
1105512304 13:21061151-21061173 CTCCGGGCGGGCGCGGACCGTGG + Intronic
1105964529 13:25372323-25372345 CCCGGGGCGGGGGCGGCGCGGGG + Intronic
1106517113 13:30465254-30465276 CGGCGGGCGAGGGCGGCGCGGGG - Intronic
1107605215 13:42049164-42049186 CCTGGGGCGCGGGCGGGGCGGGG + Intronic
1110356741 13:74575823-74575845 CCGCGGGCGCTGACGTCCCGCGG - Intergenic
1110860390 13:80340444-80340466 CCCCGGGCGAGGCAGGTCCGCGG + Intronic
1111672290 13:91347479-91347501 CCACGGGGGAGCGCGGCCCGGGG + Intergenic
1111672559 13:91348331-91348353 CCCGGGGCGCGCGCGGGGCGTGG + Intergenic
1111951690 13:94713186-94713208 CCCCGGGCGCGGCGGACTCGCGG - Intergenic
1112506339 13:99978560-99978582 GCCCGGCCGCGCGCGGCCCCTGG + Intergenic
1113820365 13:113209018-113209040 CCTCGGGCGCGCGCGCCCCGAGG - Intronic
1113820657 13:113209872-113209894 CCCCGGGAGCGGGGGCGCCGGGG + Intronic
1113874444 13:113585269-113585291 CCTCGTGCGGAGGCGGCCCGAGG + Intronic
1115718976 14:36138837-36138859 GGCCGGGCGCGGGTGGCTCGCGG + Intergenic
1117157092 14:52951439-52951461 CCCGGGGCGCTGGTGGCCGGCGG + Intronic
1117353582 14:54902930-54902952 CCCCGGGGGCGGGAGGCCGAGGG - Intergenic
1117721334 14:58631752-58631774 CCCTGGGCGGGGGCGGCCAGAGG + Intergenic
1118808928 14:69260060-69260082 CCCCGAGCGCGCGCGTCCCCCGG - Exonic
1119743259 14:77027564-77027586 CGACGGGCGGCGGCGGCCCGGGG + Exonic
1120190526 14:81436117-81436139 CACCAGCCGCGGGCGTCCCGGGG - Intronic
1121252963 14:92513527-92513549 GCTGGGGCGCGGGAGGCCCGCGG - Intergenic
1121616982 14:95319908-95319930 CGGCGGGCGCGGGCGGGGCGCGG + Intergenic
1121616991 14:95319925-95319947 GCGCGGGCGCGGGCGGGGCGGGG + Intergenic
1122081811 14:99272047-99272069 CCCCTGGCGCCGCGGGCCCGGGG + Intergenic
1122220968 14:100239031-100239053 GCGCGGGCGCGGGCGCACCGAGG + Exonic
1122221311 14:100240300-100240322 CCCCCGGCCCGGGCGGGACGCGG + Intronic
1122974985 14:105167415-105167437 CCCCGGTCCCGGGCAGGCCGCGG - Intronic
1123024837 14:105419737-105419759 CGCGGGCCGCGGGCGGCGCGGGG + Intronic
1123036688 14:105474614-105474636 CCTCCGGCGCGAGGGGCCCGGGG + Intronic
1123040326 14:105487710-105487732 CCCCGCGCCCGCGCGCCCCGAGG + Intronic
1123044146 14:105503253-105503275 CCCAGGGTGCGGTGGGCCCGGGG + Intergenic
1126348048 15:47717355-47717377 CCCCGGGCACGGACGGCAGGAGG - Intronic
1127588383 15:60398502-60398524 CCCCGGGAACTGGCGGCCAGAGG - Intronic
1128992489 15:72272508-72272530 CTGCGGCCGCGCGCGGCCCGGGG - Exonic
1129322376 15:74782312-74782334 CCGCGGGCTCCGGCGGCCAGAGG - Exonic
1129330878 15:74826552-74826574 GCCCGGGCGGGGGCGGGCGGCGG + Exonic
1130335293 15:82952711-82952733 CGCCAGGCGCGGGCGGGCGGGGG + Exonic
1131174426 15:90201236-90201258 TCCCGGGCGCTGGCAGCGCGAGG - Intronic
1132398234 15:101489578-101489600 CCGCGGGCGCGGGGGGCGCGGGG - Exonic
1132519905 16:382127-382149 ACCGGGGCGCGCGCGGTCCGGGG + Intronic
1132560224 16:590124-590146 GCCCGGGCGCGGGCGGGGCGGGG + Intronic
1132570617 16:642377-642399 CTCCGGGCGCGGGGGGTGCGCGG + Intronic
1132610520 16:813717-813739 CCCCGGGCGCTGGGGGTTCGGGG - Exonic
1132719503 16:1308970-1308992 GCCGGGGCGCGGGCGGGACGTGG - Exonic
1132719648 16:1309481-1309503 CCCGGGGCGCGGGCGCGCGGCGG + Intronic
1132759140 16:1500511-1500533 CCCCGGCCTCGGGCGCCCCGAGG + Intronic
1132809071 16:1789046-1789068 CCCAGGGTGCTGGAGGCCCGGGG - Exonic
1132828899 16:1918148-1918170 GCGGGGGCGCGGGCGGCCGGCGG + Exonic
1132851525 16:2026971-2026993 CCCTGCCCGCGGGCGGCCGGTGG + Exonic
1132875627 16:2135722-2135744 CTCCGCGCGCGGGCGGGCCTGGG - Exonic
1132877497 16:2146908-2146930 CCCAGGGCGCGGGCAGCAGGAGG - Intronic
1132889521 16:2196843-2196865 CTGCGGACGCGGGCGGCCTGGGG + Intergenic
1132945058 16:2527946-2527968 ATCCGGGCGCTGACGGCCCGTGG + Exonic
1133029622 16:3004274-3004296 GCGCGGGCGCGGGCGAGCCGCGG - Intergenic
1133117972 16:3589141-3589163 CCTCGGGCGCGGGCTCCCTGGGG - Exonic
1133212923 16:4273123-4273145 CCCCGGCCTCGCGCCGCCCGGGG - Intergenic
1134070054 16:11255359-11255381 CCGCGGGCGCGCGGGGGCCGCGG + Exonic
1134519359 16:14911631-14911653 CTCCGCGCGCGGGCGGGCCTGGG + Intronic
1134554574 16:15154597-15154619 CTCCGCGCGCGGGCGGGCCTGGG - Intergenic
1134707029 16:16310286-16310308 CTCCGCGCGCGGGCGGGCCTGGG + Intergenic
1134960511 16:18401838-18401860 CTCCGCGCGCGGGCGGGCCTGGG - Intergenic
1135190283 16:20348827-20348849 CCCCGGGCTCCTGCGGGCCGGGG - Exonic
1136365274 16:29806640-29806662 CCGGGGGCGCGGGCCGCGCGGGG - Exonic
1136491309 16:30610089-30610111 CCTCGGGCGCTGGCGGCCCCTGG + Exonic
1136778995 16:32885594-32885616 CCGAGGGCGCGGGCCGGCCGGGG + Intergenic
1136891623 16:33975924-33975946 CCGAGGGCGCGGGCCGGCCGGGG - Intergenic
1138619147 16:58197891-58197913 CCGCGGGGGCGGGCGGGCTGGGG + Exonic
1139420144 16:66844840-66844862 CCCCGGGCGTGCGCAGCGCGTGG + Intronic
1139853787 16:69965468-69965490 ACCCGGGCGCGCGCTGCCCGAGG + Intergenic
1139882765 16:70188381-70188403 ACCCGGGAGCGCGCTGCCCGAGG + Intergenic
1140369745 16:74407138-74407160 ACCCGGGAGCGCGCTGCCCGAGG - Intergenic
1141972369 16:87492513-87492535 CCCCGTGAGCGGGGGGCCCGAGG - Intergenic
1142049987 16:87951739-87951761 CGCCGGGCGCGGTGGGGCCGGGG - Intronic
1142156278 16:88534127-88534149 CCGGGGGCGCGGCCGGCCCAGGG - Exonic
1142299251 16:89247214-89247236 CCCCGCTCGGGGGCGGCCCCTGG - Intergenic
1203081406 16_KI270728v1_random:1147683-1147705 CCGAGGGCGCGGGCCGGCCGGGG + Intergenic
1142509750 17:386045-386067 CCCCGGGCGGGGGCGGTTCCGGG - Intronic
1142631592 17:1229434-1229456 CCCCGGGCCAGCGCGGCCTGCGG + Intergenic
1142631691 17:1229786-1229808 CGGCGGGGGCGGGCGCCCCGGGG + Intergenic
1142637725 17:1268412-1268434 GCCCGGGCGGGGGCGGGCGGGGG - Intergenic
1142638283 17:1270971-1270993 CCCCGCGCGCGGCCGGGCCGTGG - Exonic
1142810695 17:2394235-2394257 ACCCGGGCCCCGGCGGCCCTCGG - Intronic
1143030474 17:3964484-3964506 CCCCGGGGCGGGGCGGCGCGGGG + Intergenic
1143099762 17:4498752-4498774 CCCTGGGGGTGGGGGGCCCGGGG - Intergenic
1143112188 17:4558953-4558975 CCCCGGCCTGGGGCTGCCCGCGG - Exonic
1143496430 17:7315249-7315271 CACCGCGCGCGGGCGGCGCCGGG + Intronic
1143747150 17:9003174-9003196 GGCCGGGTGGGGGCGGCCCGCGG + Intergenic
1144756082 17:17681531-17681553 CCGCGGGCGGGGGCGGCGCCCGG - Exonic
1144756185 17:17681838-17681860 CCCGGGGCGGGGGCGGCGCGAGG + Intronic
1146492371 17:33292212-33292234 TCCCTGGCGCGGGCTGCGCGCGG - Exonic
1146581200 17:34040124-34040146 CCCCGGGCCCGGGCGGCCACGGG + Intronic
1147015681 17:37489840-37489862 CCCCGGGCGCGGGCGGAGGGAGG + Exonic
1147134895 17:38428851-38428873 CAGCGGGGGCGGGAGGCCCGCGG + Intronic
1147200879 17:38800099-38800121 CCCCGGGCGCGCTCCACCCGCGG + Intronic
1148060136 17:44830334-44830356 GCCCGGGAGCGGGGGGCGCGCGG + Intronic
1148206795 17:45784452-45784474 CTGCGGGCTCGGGCGGCACGGGG - Intronic
1148337432 17:46851341-46851363 CCCCGGGCGGGCGCGGCGCCAGG + Intronic
1148782447 17:50129618-50129640 CCCCGGCCGCGGGGGGCTCCGGG + Exonic
1148852452 17:50561542-50561564 CCCCGGCCCCGGCCGGCCCCCGG - Exonic
1148899494 17:50865823-50865845 GGCCGGGGACGGGCGGCCCGGGG - Intronic
1149610386 17:57954952-57954974 CCCCGGGCGCGGGGGGCGTGCGG - Intronic
1149994487 17:61399604-61399626 CCGCAGGCGCGGGCGGGCGGTGG + Intergenic
1150108565 17:62479022-62479044 GCCCGGGCCCGGGCGGCCGCGGG - Exonic
1150217150 17:63477105-63477127 CCCCGGCCCCCGGCGGCCCGAGG - Intergenic
1150217210 17:63477356-63477378 GCCCGGGCGGGGGCGGGGCGGGG + Intergenic
1150259213 17:63774494-63774516 CCCCGGCCGCCGGTGCCCCGAGG - Intronic
1150675742 17:67245028-67245050 CCCCGGGCGCGGCGGCCCCGGGG - Intronic
1151154594 17:72115954-72115976 CCCGGGGGGCGGGAGGCCCTCGG + Intergenic
1151565202 17:74893700-74893722 CCCCGGGGGCGGGTGTCCCCAGG - Intronic
1151662569 17:75526315-75526337 CCCCGGACGCAGGAAGCCCGCGG + Intronic
1151791425 17:76308098-76308120 CCCGGGGCAGGGGCGCCCCGAGG - Intergenic
1152245549 17:79183049-79183071 CCCAGGGCGCGCGCGGCGCGAGG - Intronic
1152362615 17:79839570-79839592 CCCCGGGCCTGGGCGGCGGGGGG + Intergenic
1152468004 17:80476529-80476551 CCCAGAGCGCGGGCCGCTCGCGG - Exonic
1152616799 17:81341631-81341653 CCCTCGGCGAGTGCGGCCCGTGG - Intergenic
1152649995 17:81488327-81488349 CCTCGGGCGCGGCGGGGCCGGGG - Intergenic
1152748552 17:82052091-82052113 CCCCCGACGCGCGCTGCCCGCGG - Exonic
1152930940 17:83109577-83109599 CCCCGAGCGAGGGTGGCCAGTGG - Intergenic
1153457219 18:5295268-5295290 CCCCGGCCGCGGGAGGGCGGGGG - Intronic
1153457235 18:5295285-5295307 CCGGGGGCGGGGGCGGCGCGCGG + Intronic
1153997430 18:10454517-10454539 CCCCCGGCGGCGGCTGCCCGGGG + Intergenic
1155928807 18:31685092-31685114 CGCCGGGCCCCGGCGCCCCGCGG + Intronic
1156008466 18:32470545-32470567 CTCCGGCCGCGGGCAGCCGGGGG + Intergenic
1156460505 18:37319016-37319038 CCCCAGGCGGGGGCAGCCAGAGG - Intronic
1157529335 18:48408793-48408815 CTGCGGGCGCGTGCGGCCCGGGG - Intronic
1157610126 18:48950679-48950701 CGCAGGGCGCGGGCCGCGCGGGG - Exonic
1157815957 18:50729655-50729677 CACCGGGGCCGGGCGGCCGGGGG - Exonic
1158259043 18:55587918-55587940 CGCCGGGCGCCGGGAGCCCGCGG + Intronic
1159040325 18:63318527-63318549 CCCGGTGCGGGGGCGGCCCCCGG + Exonic
1159045551 18:63366563-63366585 CCCCGGGCGGGGGCAGACAGCGG - Intronic
1159946351 18:74447142-74447164 CGACTGGCGCGGCCGGCCCGTGG - Exonic
1160164120 18:76495340-76495362 CCCCGGACGCGTCCGCCCCGCGG + Intergenic
1160540473 18:79617663-79617685 CCCCGGGCGAGGGCAGACCGTGG - Intergenic
1160662151 19:306197-306219 CCCAGGGCTGGGGCAGCCCGCGG + Exonic
1160691087 19:460936-460958 CCTCGGGCTCGGGGGGCGCGGGG + Exonic
1160725559 19:616490-616512 CCGCGGGCCCAGGCGGGCCGGGG + Exonic
1160858669 19:1228518-1228540 CTCGGGGCGCGGGAGGGCCGGGG + Exonic
1160861811 19:1240352-1240374 GCGCGTGCGCGGGCGGCTCGGGG - Intergenic
1160864100 19:1249593-1249615 CTGCGGGCGCGGGCGGGGCGGGG + Intronic
1160876666 19:1299747-1299769 CCCTGAGGGCGGGCGGCACGTGG + Intronic
1160927955 19:1556008-1556030 CGCCGGGCGCCGGCGGCGGGAGG + Exonic
1160937813 19:1605475-1605497 CCCCGCGCGCGTGCGCGCCGCGG - Exonic
1160991868 19:1863398-1863420 CCTCGGGGCCGGGCCGCCCGCGG + Exonic
1161062534 19:2222365-2222387 CCACGGGCGCTGGCGGTCAGGGG - Exonic
1161087299 19:2341029-2341051 CCCCGGGCCCCGGCGGGCAGCGG + Exonic
1161102395 19:2427588-2427610 CGCCGGAAGCGGGCCGCCCGGGG + Exonic
1161150104 19:2702870-2702892 CTCCGGGCGCGGGCGGGGCCGGG + Intergenic
1161231957 19:3178897-3178919 GGCCGGGCGCGGGGGGCCGGAGG + Exonic
1161388168 19:4007879-4007901 CCCACAGCGCGGCCGGCCCGCGG + Intronic
1162071343 19:8154228-8154250 CTCGGGGCGGGGGCGGTCCGGGG - Intronic
1162445132 19:10718225-10718247 CCCATGGCGCCGGCGGCCCCCGG - Exonic
1162470948 19:10871728-10871750 GGCCGGGCGCGGGCGGCGCGGGG + Exonic
1162929763 19:13952088-13952110 GACCGGGCGCGGGCAGCCCGGGG + Intronic
1163138824 19:15332568-15332590 CACCGGGCGGCGGCGGCGCGGGG - Intergenic
1163358297 19:16829379-16829401 CCTCGGGCGGGGGCGGGGCGGGG + Intronic
1163490823 19:17616368-17616390 CACCAGGCGCGGGCGGCGGGCGG + Intronic
1165058633 19:33194452-33194474 CCCCGGGCCCAGGCCGGCCGCGG + Intronic
1165061456 19:33207099-33207121 CACCGGCCGCGGGCGCCCCGAGG + Exonic
1165349598 19:35268810-35268832 CGCCGGCTCCGGGCGGCCCGAGG - Intergenic
1166222841 19:41376714-41376736 CCCCGCGCGCAGCGGGCCCGGGG + Exonic
1166551800 19:43670306-43670328 CCCGGGGCGCGGCCGGCTGGTGG + Exonic
1166788212 19:45382148-45382170 GCCCGGGTGGGGGGGGCCCGAGG + Intronic
1166809654 19:45507723-45507745 CCCCGGGAGCAGCCAGCCCGTGG + Exonic
1166984018 19:46649161-46649183 CCACGGCGGCCGGCGGCCCGGGG + Exonic
1167048821 19:47066879-47066901 CCCCGCGTGCTGGCGGCCGGTGG - Exonic
1167072984 19:47231247-47231269 CGCCGGGCGGGGGCGGGGCGGGG - Intronic
1167258148 19:48443144-48443166 GGCCAGGCGCGGGCGGCGCGGGG + Exonic
1168144893 19:54415471-54415493 AGCGGGGCGCGGGCGGCGCGGGG - Intronic
1168408047 19:56120934-56120956 ACGCGCGCCCGGGCGGCCCGCGG - Intronic
1168719036 19:58544804-58544826 GCCCGGGCCCGGGCTGCCAGAGG - Exonic
924987932 2:288256-288278 CCCCGGCCGCGGGCGGACCTCGG + Exonic
925419965 2:3703760-3703782 CCACCGGCGCGGAGGGCCCGCGG - Exonic
925609536 2:5692093-5692115 CACGGGGAGCGGGCGGCCCGGGG - Intergenic
925905235 2:8536191-8536213 CCCAGGGGGCGGGAGGCACGTGG + Intergenic
925959739 2:9003707-9003729 CTCCGACCGCGGGCGGCCCAGGG - Exonic
925984806 2:9206955-9206977 CGCCGGGCGCGGGAGCCGCGCGG - Exonic
925984960 2:9207553-9207575 CCCCGGGCGGCGGCGGGCGGCGG - Intronic
926422930 2:12716831-12716853 GCCCGGGCGGGGGCGGGGCGGGG + Intergenic
927904617 2:26847942-26847964 CCCCAGGCGGCGGCGGCGCGCGG + Intronic
929000627 2:37344526-37344548 CCCCGGGGCTGGGCGGCCCTGGG - Intergenic
929452904 2:42048412-42048434 CCCCGGGCCCGGGGCCCCCGCGG - Exonic
929780332 2:44953037-44953059 GACCGGGAGCGGGCGGCCCTGGG + Intergenic
930700833 2:54456688-54456710 GCCCGGGCGGGGGCGGCGCGGGG + Intronic
931671642 2:64653565-64653587 CCGCGGGCGCGGGGGGCTCCGGG - Intronic
932288150 2:70553880-70553902 CCCCCGGCGCGGGAGGGCGGAGG + Exonic
932316938 2:70790696-70790718 GCCCGGGCGGGGGCGGGGCGGGG + Intergenic
932342999 2:70978577-70978599 CCCCGGGGGCGGGGCGCCGGCGG + Intronic
932572066 2:72943358-72943380 CCCCGGGGGAGGGAGGCCTGGGG + Exonic
932700022 2:73985524-73985546 CGGCGGGCGCGGGCTGCCCAGGG + Intergenic
932812049 2:74834019-74834041 CCACGGCGGCGGGCGGTCCGTGG + Exonic
932812284 2:74835074-74835096 CCGCGAGCGCGGACGGCCCCCGG - Intronic
933133437 2:78701708-78701730 CCCCGGGAGGGGGCGGGGCGGGG + Intergenic
933206376 2:79512796-79512818 CCGCGGGCGCGCGCGGCCTGGGG - Intronic
933834274 2:86232698-86232720 CCCCGGTGGTGGGGGGCCCGAGG + Exonic
935250137 2:101253426-101253448 CGCCGCGGGCGGGCGGCGCGGGG - Exonic
935396955 2:102619510-102619532 CCCCGCCCGCGGGCCGCCCTGGG + Intergenic
935790290 2:106584489-106584511 GCCCGGGAGTGCGCGGCCCGCGG - Intergenic
935991149 2:108719943-108719965 GCCCGGGCCAGGGCGGCCCCAGG - Intronic
936713661 2:115161566-115161588 CCCCGGGGGCGGGCGGTGGGGGG + Intronic
941021085 2:160408058-160408080 AGCCGGGGCCGGGCGGCCCGGGG + Intronic
942043674 2:172086894-172086916 ACCCGGGCGCAGGCCGGCCGCGG - Intronic
942098551 2:172556182-172556204 CCCCGGGCCCGGGCCGGCCAAGG - Exonic
942240973 2:173964253-173964275 CCCCGGGAGCTGCCCGCCCGAGG - Intronic
942446068 2:176079967-176079989 CCCGGGGCGCGGGAGGCCGAAGG - Exonic
942966052 2:181892670-181892692 CCCGGGACGCGGGCGGACCAGGG - Intronic
944831238 2:203535450-203535472 CGGCGGGCGGGGGCGGCGCGCGG - Intergenic
945431709 2:209772186-209772208 CCCCAGCCCAGGGCGGCCCGCGG - Intronic
946395522 2:219442091-219442113 CTCCGGGGGCGGGCGGCGCCGGG + Intronic
946966422 2:225042201-225042223 CCCCGGGCGCCTGGGGCGCGCGG + Intronic
947860494 2:233354475-233354497 CCGCGGGCGGGGGCGGGGCGGGG - Intergenic
947992299 2:234497154-234497176 CCCCGGCGGCGGGCGGGGCGGGG - Intergenic
948942476 2:241203312-241203334 CCCTGGGGGCGAGCGGCCTGTGG - Exonic
1168753095 20:297646-297668 CCCGGGCCGCGGGCCGCGCGGGG - Exonic
1168795892 20:610060-610082 CCCCGGGGGCGGGCGGCGGGCGG - Exonic
1169048663 20:2558552-2558574 CCCCGGGCTTGGGCTGCCCCCGG - Exonic
1169262556 20:4149083-4149105 CCGAGGGCTCGGCCGGCCCGGGG + Intronic
1172100597 20:32482647-32482669 CCGCGGGCGTTGGCGGCCCCTGG - Intronic
1172146590 20:32762267-32762289 GCCCGGGCGCGGGGGGAACGGGG - Intergenic
1172408209 20:34704561-34704583 GCCCGGGCGCGGGGGGCGCAGGG - Intronic
1172474431 20:35226625-35226647 CCCCGGTGGGGGGCGGCCGGGGG - Intergenic
1172702723 20:36863033-36863055 ACCCGAGCGCGGACGGCCCTTGG + Exonic
1173813603 20:45971350-45971372 CCCTGGGCCTGGCCGGCCCGAGG - Exonic
1173827595 20:46057627-46057649 GCCCGAGCGCGCCCGGCCCGCGG + Exonic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1175267082 20:57709602-57709624 CGCGGGGCGCGGGGGGCTCGGGG + Exonic
1175333485 20:58179994-58180016 CCCCGCGCGTGGGTGGCCCCCGG + Intergenic
1175399650 20:58693092-58693114 GCCCAGGCCCGGGCGGCCCGCGG + Intronic
1175847342 20:62065663-62065685 CCTCGGGCGTGCGCGGCGCGAGG + Exonic
1175998329 20:62821195-62821217 CCCCCAGCCCGGGCGGCCCCGGG - Exonic
1176014890 20:62926065-62926087 GCCTGGGCGAGTGCGGCCCGGGG - Intronic
1176131762 20:63499297-63499319 CCGCGGGCGGGGGCGGGGCGGGG + Exonic
1176145303 20:63562747-63562769 CCCAGGGCGTGGGCTGGCCGTGG + Exonic
1176189891 20:63803550-63803572 CCCGGGGCCTGGGCAGCCCGGGG - Intronic
1176216233 20:63949276-63949298 GACCAGGCGAGGGCGGCCCGGGG + Intronic
1176428891 21:6564317-6564339 CCTGGGGCGCGTGAGGCCCGTGG + Intergenic
1178350881 21:31872765-31872787 CCCCGGGTGGGTGCGGCCAGTGG + Intergenic
1178922579 21:36748094-36748116 CTCCTGGCGCGGGCGGCCAGCGG - Exonic
1179581568 21:42347767-42347789 CCCCGGGGGAGGCCGTCCCGGGG - Intronic
1179704381 21:43172633-43172655 CCTGGGGCGCGTGAGGCCCGTGG + Exonic
1180014970 21:45075501-45075523 TCCCTGGCCCGGGCCGCCCGCGG - Intronic
1180622520 22:17171601-17171623 GCCCGGGCGCGGCCGGCAGGGGG + Intergenic
1180997153 22:19971287-19971309 CCCCGGGCCCAGCAGGCCCGCGG - Exonic
1181094327 22:20495538-20495560 CCCCGGGCGCGGGCGCGTAGGGG - Intronic
1181568024 22:23751404-23751426 CCCCGAGTGCCGGCGGCTCGAGG - Intergenic
1182532134 22:30968880-30968902 CGCGGCGCGCGGGCGGCGCGCGG - Intergenic
1184265432 22:43343530-43343552 CCCCTGGGGCGGGCGGCAGGTGG + Intergenic
1184265566 22:43344050-43344072 CCCCGTGCGGGGGCCTCCCGCGG - Intergenic
1184337558 22:43862631-43862653 CCCCGGCCGGGGGCGGGGCGGGG - Intergenic
950610600 3:14124554-14124576 CGCCGGGCGCGGGCCACCTGAGG - Intronic
951881429 3:27484283-27484305 CGCCGGGCGCGGGAGACGCGGGG + Intronic
953912199 3:46898867-46898889 CACCGGGAGCGGGCGGGCAGAGG - Intronic
954076866 3:48188032-48188054 CCGCGGGCGCCGGTGGCGCGCGG - Exonic
954395724 3:50292281-50292303 AACCGGGCGCGGGGGGCGCGGGG + Exonic
954540839 3:51392119-51392141 CGGCGGGCGCGGGCGGCCCTGGG - Exonic
955161389 3:56468181-56468203 GCCCGGGCACGGGCGCCCCGAGG + Intronic
955687582 3:61562154-61562176 CGCCGAGCGCGGGGGGCCCGTGG + Exonic
956659334 3:71583079-71583101 CCCCGCGCCCGGGCGGCCACCGG + Intronic
958004285 3:87792771-87792793 CCCGGGGCGCGGGAGGGCAGGGG - Intergenic
961013144 3:123448935-123448957 GCCCGGGCACTGCCGGCCCGAGG - Exonic
961446342 3:126983351-126983373 GTCCGGGGCCGGGCGGCCCGTGG + Intergenic
961518877 3:127455707-127455729 CAGGGGGCGCTGGCGGCCCGCGG - Intergenic
961779922 3:129315438-129315460 CCCCGGGCGCGGCCGGCTCCCGG - Exonic
962751003 3:138434823-138434845 CCCAGGGCGCTGGGGGCCCCGGG - Exonic
963236795 3:142963861-142963883 GCCCGGGCTGCGGCGGCCCGAGG - Intergenic
964282329 3:155080053-155080075 CCCAGGGCGCTGGGAGCCCGTGG + Intronic
966696287 3:182793544-182793566 CGCCGGGCGGGGGCGGCGCCGGG + Exonic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
968048057 3:195635177-195635199 CCCCGGCCTTGGGCGGCCCTGGG + Intergenic
968099345 3:195954443-195954465 CCCCGGCCTTGGGCGGCCCTGGG - Intergenic
968306554 3:197654744-197654766 CCCCGGCCTTGGGCGGCCCTGGG - Intergenic
968479111 4:826049-826071 CCCGGGGCGCGGGCGGTCAGCGG + Exonic
968515138 4:1012543-1012565 CCTCGGGCGGCGGCGGCCGGCGG - Exonic
968518337 4:1024112-1024134 CCCCGGGCGCTGGCGGGCGGGGG + Intronic
968556558 4:1248865-1248887 CCGCGGGCGGGGGCGGGGCGGGG - Intronic
968652897 4:1767134-1767156 CCCCGGAGGCGGGCGGGCGGAGG - Intergenic
968878666 4:3287559-3287581 CCCCTGGCCCTGGCGGCCCGAGG + Intergenic
969330772 4:6472443-6472465 CCGCGGGTTCGGGCGGGCCGGGG + Intronic
969635212 4:8365162-8365184 CCCCGGGCCCGTGAGGCCTGTGG + Intergenic
973931072 4:55793695-55793717 CCCCGGGCGGGCGCGGCCTCAGG + Intergenic
975395523 4:73869593-73869615 CCCCAGCCGCGTCCGGCCCGGGG - Intronic
975409969 4:74038467-74038489 CCCCAGCCGCGTCCGGCCCGGGG + Intronic
975415357 4:74098976-74098998 CCCCAGCCGCGTCCGGCCCGGGG + Intronic
982291850 4:153789428-153789450 GCCCGGGCCCCGGCGGCACGCGG - Intergenic
982460901 4:155667621-155667643 CCCAGGGCCCGGGGGACCCGCGG + Intronic
984668035 4:182448967-182448989 CTCCGGGCTCGGGCTGCGCGCGG - Intronic
985112013 4:186555590-186555612 ACCGGGGCGCTGTCGGCCCGTGG - Intergenic
985512832 5:321846-321868 CCCCCGCCGCGTGCCGCCCGCGG + Intronic
985565336 5:612505-612527 CCCGGGGCGGCGGCGGACCGTGG + Intronic
985580604 5:693592-693614 CGCAGGGCGCGGCCGACCCGCGG + Intergenic
985743534 5:1633864-1633886 CCCCAGCCCCGGGCGGCCCTGGG - Intergenic
985896167 5:2751140-2751162 AACCGGGCGCGGGCGGGACGCGG - Intronic
987193254 5:15500388-15500410 CCCGGGGCGCGGGCTGTGCGCGG + Exonic
989147057 5:38259017-38259039 CCCCGAGCCCGGGCGGCGCTAGG + Intronic
993901212 5:93585096-93585118 CCCGCAGCGCAGGCGGCCCGCGG + Exonic
994072838 5:95620888-95620910 GGCCAGGCGCGGGCGGCCGGGGG - Exonic
996948266 5:129095165-129095187 CCCGGGTCCCGGGCGGCTCGGGG - Intronic
998152335 5:139764595-139764617 CGCCGGGGGAGGGCGGCGCGCGG - Intergenic
998199582 5:140108533-140108555 CCCAGGGCGAAGGCGGCCAGGGG - Intronic
998328598 5:141304046-141304068 CGCGGGGAGGGGGCGGCCCGCGG - Intergenic
998332766 5:141344199-141344221 CCCCGGGAGCTGGCGGAGCGCGG + Exonic
998334067 5:141355366-141355388 CCCCGGGAGCTGGCGGAGCGCGG + Exonic
998337108 5:141383065-141383087 CCCCGGGAGCTGGCGGAGCGCGG + Exonic
998340481 5:141413353-141413375 CCCCGGGAGCTGGCGGAGCGCGG + Exonic
999129448 5:149271799-149271821 GCGCGGGCGCGGGCGGGGCGGGG + Intergenic
999341676 5:150778716-150778738 CCCCGGGACCGGGCGTTCCGGGG + Exonic
1001159500 5:169300854-169300876 CACGGGGCGCGGGCGGAGCGGGG + Intronic
1002185960 5:177454935-177454957 CCGCGGCCGGGGGCTGCCCGTGG - Exonic
1002186134 5:177455635-177455657 GCTGGGGCGCGGGCGGCCCCTGG + Intronic
1002508668 5:179698686-179698708 CGCCGGGCGCGCGCGTCTCGGGG - Intronic
1002526174 5:179817172-179817194 GACGGGGCGCGGGCCGCCCGTGG - Intronic
1002638389 5:180619197-180619219 CCCCGGGCGCGGGGCGCCGCGGG - Intronic
1002784912 6:393127-393149 GCGCGGGCGCGGACGGCACGCGG + Exonic
1002888078 6:1312994-1313016 GGCCAGGCGCGGGCGGCGCGGGG + Exonic
1003098159 6:3157803-3157825 CCACGGGCACGGGCGACCCCTGG + Intergenic
1003290867 6:4776884-4776906 CGGCGGGCGCGGGCGGCGAGCGG - Intronic
1004228991 6:13814248-13814270 CCTCGCGCCCCGGCGGCCCGCGG - Exonic
1004395774 6:15245558-15245580 CCCCGGGGCCGGGCGTCCTGGGG + Intergenic
1005841698 6:29748263-29748285 CCCCGGCAGCGGGAGGCCAGGGG + Intergenic
1006423870 6:33951650-33951672 CCCAGAGCACGTGCGGCCCGTGG - Intergenic
1007444512 6:41895020-41895042 CCCGGGGCGGGGGCGGCGGGAGG - Intronic
1007465687 6:42049586-42049608 CCCAGGGCGTGGGGTGCCCGCGG - Intronic
1007781547 6:44257455-44257477 CGCAGGGGGCGCGCGGCCCGGGG - Exonic
1011277042 6:85642264-85642286 CCCCGGGCGCCGACGACCCCCGG + Intronic
1013048848 6:106512525-106512547 CCCCCGTCGAGGGCTGCCCGCGG - Exonic
1013155675 6:107489868-107489890 CGGCGGGCACGGGCGGCTCGCGG - Intergenic
1013170745 6:107634733-107634755 GCCCGCGCCCGGGGGGCCCGGGG - Exonic
1014550958 6:122789400-122789422 CTCCGGCCTCGGGCTGCCCGTGG + Exonic
1016330047 6:142945794-142945816 GCCCGGAGGCGGGCGGCCGGCGG - Intergenic
1016330373 6:142947056-142947078 CCCCTGGCGAGGGCGGGCCGCGG - Intergenic
1016433147 6:144008444-144008466 CCCCTGGCGGGGGCGTCACGTGG + Intronic
1016863961 6:148747769-148747791 CCCGGGGCGGCGGCGGCGCGCGG - Intronic
1017725826 6:157275198-157275220 GGCCGGGCGCGGGCGGCGGGAGG + Intergenic
1018686532 6:166308099-166308121 CCCGGGGCGGGGGCGGGCGGCGG + Exonic
1018755892 6:166849560-166849582 CCACGGGCGGGGGTGGCCTGGGG - Intronic
1019298449 7:290976-290998 CCCCGGTCCAGGGCGCCCCGAGG + Intergenic
1019551338 7:1604081-1604103 CCGGGCGAGCGGGCGGCCCGGGG - Intergenic
1019765100 7:2844179-2844201 CCCCGGGCGCCGGCGGGGCGCGG - Exonic
1020080293 7:5283001-5283023 CGCCGGGCGCGCCCGGCCCGAGG + Exonic
1020130206 7:5555306-5555328 CGGTGGGCGGGGGCGGCCCGTGG - Intronic
1020278230 7:6637283-6637305 CCGCGGGCGCGGGCGGGGCGGGG + Intergenic
1022506371 7:30910622-30910644 CCCGGGGCACAGGCGGCCCACGG + Intergenic
1023435124 7:40134457-40134479 CCCCGGGCGGGGGCGGACCACGG - Exonic
1023791864 7:43758894-43758916 CTCCGGGCCCGGGCGGGGCGGGG - Intronic
1024472126 7:49775280-49775302 GCCGGGGCGCGCGCGGGCCGCGG + Intronic
1025198632 7:56949205-56949227 CGCCGGGCGCGCCCGGCCCGAGG - Intergenic
1025673320 7:63627731-63627753 CGCCGGGCGCGCCCGGCCCGAGG + Intergenic
1026909405 7:74083739-74083761 GGCGGGGCGCGGGCGGCCGGCGG - Intronic
1026982757 7:74536287-74536309 CCCCTGGCCCCGGAGGCCCGCGG + Intronic
1027232639 7:76281663-76281685 CCCCGGGGGGGCGCGGGCCGGGG - Exonic
1028417453 7:90595917-90595939 TCCCGCGCGCGGGCGGGGCGGGG + Intronic
1028762488 7:94510442-94510464 ACCCCAGCGCGGGCGGCTCGGGG - Intronic
1029363021 7:100100843-100100865 CCCCGGGGGCGGGCAGGCCGGGG - Intronic
1029461070 7:100694133-100694155 CCCGGGGCGTGGGCGGCGCGCGG + Intergenic
1029927094 7:104329259-104329281 TCCCCGGCTCGGGCGCCCCGGGG - Intronic
1032020711 7:128405972-128405994 CCCCCGGCCCGCCCGGCCCGCGG - Intronic
1032119326 7:129144993-129145015 CCCCGGGCGCCGGCCGCCTCCGG + Exonic
1033654378 7:143362828-143362850 GCCGGGGAGGGGGCGGCCCGGGG + Intergenic
1034344816 7:150379556-150379578 CCCGGGGCTCGGGGGGCGCGCGG - Intronic
1034393266 7:150801674-150801696 CCCCTGGCCTGGGTGGCCCGGGG - Exonic
1034618122 7:152436150-152436172 CTCCTGCCGCGGGCGGCTCGGGG - Intergenic
1035167341 7:156999790-156999812 CCGCGGGCCGGGGCGGGCCGGGG - Intronic
1036432240 8:8702083-8702105 GTCCGGGCGCGGGCGCCCAGGGG - Exonic
1036811121 8:11868167-11868189 CACCGTGCGCGGGCGGCGGGAGG - Exonic
1037305151 8:17497032-17497054 CCCGGGGCGGGGGCGGGGCGCGG - Intergenic
1041712943 8:60910070-60910092 CCCCGGGCGCGCAGGGCCCGCGG - Intergenic
1042271560 8:66961612-66961634 TTCCGGGAGCGGGCGGCCGGCGG - Exonic
1044819277 8:96144998-96145020 GCCCGGGCGCGGGCGCCGAGGGG - Exonic
1045327283 8:101126652-101126674 CACCGGGCGGGGGCGGCTGGGGG - Intergenic
1047100162 8:121667532-121667554 CCCCCGGCGGGGGCGGGGCGGGG + Intergenic
1047739396 8:127794571-127794593 CCCCGAGCCCGCCCGGCCCGCGG - Intergenic
1047961681 8:130016146-130016168 CGGCGGGCGCGGGGGTCCCGGGG - Intronic
1048980813 8:139702671-139702693 CCCGGGGCGCGGGAGCCCAGCGG + Intronic
1049166277 8:141128264-141128286 CCCAGGGAGCGGGCGGCCGGCGG + Intronic
1049409035 8:142464274-142464296 CGCCGCGCGCGGGCGGCCGCCGG + Exonic
1049544183 8:143221815-143221837 CCCCAGCCGAGGGCGACCCGAGG + Intergenic
1049621105 8:143598667-143598689 CCCCGGGCGCAGGGGACCCCGGG + Exonic
1049663115 8:143829243-143829265 CCATGAGCGCGGGCGGCCCTCGG - Intronic
1049693764 8:143973765-143973787 CCCTGGGCGGGGGCCACCCGAGG - Intronic
1049762560 8:144337782-144337804 CGCCGGGCGCGGGGGCTCCGGGG + Intergenic
1049879506 8:145052382-145052404 CGCGGGGCGCGGGCGGGGCGCGG - Exonic
1051174015 9:14346121-14346143 CCGCGGGCGCGGGGGGCGCGTGG + Intronic
1051896557 9:21994715-21994737 CCCTCAGCGCGGGCGCCCCGCGG + Intronic
1053312373 9:37027728-37027750 CTCCGGGCGGGGGCGGGGCGGGG + Intronic
1053408974 9:37903701-37903723 CCCCGGGCGCAGGCAGCTCCCGG + Exonic
1053435204 9:38069395-38069417 CCCCGGGCGCGAGGGGGGCGGGG - Intergenic
1056475358 9:86947069-86947091 CCCCGGGGGGGTGCGGGCCGCGG + Exonic
1057883071 9:98807853-98807875 CCCGGGGCGCGGGGTGCGCGGGG - Exonic
1058967162 9:110048834-110048856 CCCCGGGAGCGGGCGCCCAGAGG + Exonic
1059021268 9:110579384-110579406 CGCCAGGAGCGGGCGGCGCGGGG + Exonic
1059102309 9:111483229-111483251 CCCCGGGCCAGGGCGGATCGCGG + Intronic
1059208264 9:112486805-112486827 GGCGGGGCGCGGGCGGGCCGGGG - Intronic
1059375343 9:113876452-113876474 CCCCGGGCCCCGGCCCCCCGGGG - Intronic
1060477952 9:123999691-123999713 CTGCGGGCGCGTGCGGCCGGGGG - Intergenic
1061264322 9:129496721-129496743 TGGCGGGCGCGGGCGGCCCCGGG - Intergenic
1061347947 9:130042466-130042488 CCCCGGGAGCGGGGCGGCCGGGG - Intronic
1061490050 9:130939557-130939579 CCCCTTGCCCGGGCGGCCCGTGG + Intergenic
1062078200 9:134603657-134603679 CCCTGGGCGCTGGAGGCCCGAGG - Intergenic
1062160167 9:135075564-135075586 CACCCGGAGCGGGCGGCGCGCGG - Intronic
1062341260 9:136094875-136094897 CCCCGGCTCCGGGCGTCCCGGGG - Intronic
1062428584 9:136517107-136517129 GCCGGGGTGCGGACGGCCCGAGG + Intronic
1062447620 9:136602217-136602239 CCCCGGCCGCAGGAGTCCCGTGG - Intergenic
1062587298 9:137255160-137255182 GCCCGGGCGCGGGCGGGACCGGG + Exonic
1062621130 9:137423083-137423105 CACCTGGCCCGCGCGGCCCGGGG + Intronic
1062624080 9:137435170-137435192 CCCTGGGCGTGGGCGGGGCGTGG - Intronic
1185610540 X:1391750-1391772 CCCCGGAAGCCGGCGGCGCGTGG + Intronic
1185877768 X:3713780-3713802 CCCCGGGCGCGGAGGGGGCGTGG - Intergenic
1186426124 X:9465288-9465310 GGCGGGGCGGGGGCGGCCCGGGG + Exonic
1189308602 X:40005395-40005417 CCCGGGGCGCGGGCGAGCCCTGG + Intergenic
1189354228 X:40299094-40299116 GCCCGGGCGGGGGCGGGGCGCGG + Intergenic
1189446706 X:41086444-41086466 CCCCGGGTGCGGACGGCGGGGGG - Intronic
1189659340 X:43279765-43279787 CCCCCGGCCCGCCCGGCCCGAGG - Intergenic
1190233453 X:48599368-48599390 CCTCGGGCCCTGGGGGCCCGTGG + Exonic
1190829109 X:54044497-54044519 ACCCGGGAGCCGGCGGCTCGCGG - Intronic
1192580477 X:72277122-72277144 CCCCCGGCCGGGGCTGCCCGAGG - Intronic
1196842542 X:119871809-119871831 CCCCGCTCGCGGGCGGCCGCGGG + Exonic
1199772638 X:150984151-150984173 GCCCCGGCGCCCGCGGCCCGGGG + Intronic
1200100810 X:153688460-153688482 CCGAGGGCGCGGGCCGGCCGGGG - Exonic
1200233715 X:154458478-154458500 CCCGGGGCTCCGGCAGCCCGGGG + Intronic
1200787555 Y:7273759-7273781 CCCCGGGCGCGGAGGGGGCGTGG + Intergenic