ID: 1070578844

View in Genome Browser
Species Human (GRCh38)
Location 10:77703404-77703426
Sequence CTGTGTGACCACATGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070578844_1070578849 16 Left 1070578844 10:77703404-77703426 CCTTCTGCCATGTGGTCACACAG No data
Right 1070578849 10:77703443-77703465 AGAGGCCAGCACCTTGATCTTGG No data
1070578844_1070578847 -2 Left 1070578844 10:77703404-77703426 CCTTCTGCCATGTGGTCACACAG No data
Right 1070578847 10:77703425-77703447 AGCAAGAAGGTCCTCGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070578844 Original CRISPR CTGTGTGACCACATGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr