ID: 1070578849

View in Genome Browser
Species Human (GRCh38)
Location 10:77703443-77703465
Sequence AGAGGCCAGCACCTTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070578841_1070578849 23 Left 1070578841 10:77703397-77703419 CCTCCCACCTTCTGCCATGTGGT No data
Right 1070578849 10:77703443-77703465 AGAGGCCAGCACCTTGATCTTGG No data
1070578844_1070578849 16 Left 1070578844 10:77703404-77703426 CCTTCTGCCATGTGGTCACACAG No data
Right 1070578849 10:77703443-77703465 AGAGGCCAGCACCTTGATCTTGG No data
1070578845_1070578849 9 Left 1070578845 10:77703411-77703433 CCATGTGGTCACACAGCAAGAAG No data
Right 1070578849 10:77703443-77703465 AGAGGCCAGCACCTTGATCTTGG No data
1070578842_1070578849 20 Left 1070578842 10:77703400-77703422 CCCACCTTCTGCCATGTGGTCAC No data
Right 1070578849 10:77703443-77703465 AGAGGCCAGCACCTTGATCTTGG No data
1070578843_1070578849 19 Left 1070578843 10:77703401-77703423 CCACCTTCTGCCATGTGGTCACA No data
Right 1070578849 10:77703443-77703465 AGAGGCCAGCACCTTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070578849 Original CRISPR AGAGGCCAGCACCTTGATCT TGG Intergenic
No off target data available for this crispr