ID: 1070580543

View in Genome Browser
Species Human (GRCh38)
Location 10:77715879-77715901
Sequence AACCCTATGCTGGATGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070580539_1070580543 17 Left 1070580539 10:77715839-77715861 CCATTCTTCAGAAATCTTTAGAA No data
Right 1070580543 10:77715879-77715901 AACCCTATGCTGGATGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070580543 Original CRISPR AACCCTATGCTGGATGTCAC AGG Intergenic
No off target data available for this crispr