ID: 1070580866

View in Genome Browser
Species Human (GRCh38)
Location 10:77718372-77718394
Sequence GGTCAGATTGAACACAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070580858_1070580866 25 Left 1070580858 10:77718324-77718346 CCCAGCTCTTGAGATAGCAGCAG No data
Right 1070580866 10:77718372-77718394 GGTCAGATTGAACACAGCTAAGG No data
1070580859_1070580866 24 Left 1070580859 10:77718325-77718347 CCAGCTCTTGAGATAGCAGCAGA No data
Right 1070580866 10:77718372-77718394 GGTCAGATTGAACACAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070580866 Original CRISPR GGTCAGATTGAACACAGCTA AGG Intergenic
No off target data available for this crispr