ID: 1070583572

View in Genome Browser
Species Human (GRCh38)
Location 10:77743474-77743496
Sequence CCTCACATGGTAAAGGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070583572_1070583579 17 Left 1070583572 10:77743474-77743496 CCTCACCCCTTTACCATGTGAGG No data
Right 1070583579 10:77743514-77743536 CATCTATGAGCCAGAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070583572 Original CRISPR CCTCACATGGTAAAGGGGTG AGG (reversed) Intergenic
No off target data available for this crispr